ID: 1003481226

View in Genome Browser
Species Human (GRCh38)
Location 6:6535129-6535151
Sequence AAAGCTGCTGAAACTGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003481226 Original CRISPR AAAGCTGCTGAAACTGTAAT TGG Intergenic
901189530 1:7399832-7399854 AAATCTGCTGATAGTTTAATGGG + Intronic
901530052 1:9847026-9847048 TAAGCTGCCTAAACTGTCATGGG - Intergenic
907466881 1:54644052-54644074 AAAACTGCTGAAACTTCAAATGG - Intronic
909424869 1:75511575-75511597 AATGCTGGTGAAATTGTACTGGG - Intronic
910097147 1:83536665-83536687 AAACTTGCTGAGACTTTAATTGG - Intergenic
910596241 1:88983741-88983763 AAAGCTCTTGAAACAGTATTTGG - Exonic
911058325 1:93726504-93726526 AAAGCTGATGTAATTGTGATAGG + Intronic
911185647 1:94901676-94901698 AAAGCTGGCCAAAGTGTAATTGG - Exonic
913479945 1:119278430-119278452 GAAGCTGTAGAAACTGTACTAGG - Intergenic
916228041 1:162509454-162509476 AAAGCAGCTGAAACTATAAGGGG - Intronic
916887145 1:169080953-169080975 ATAGCTGGTGAAAATGGAATAGG + Intergenic
917805258 1:178607354-178607376 AAAGCTGCTGAAACTATAGCTGG + Intergenic
918664394 1:187131405-187131427 AAATCTGCTGATAGTCTAATAGG - Intergenic
919000839 1:191828991-191829013 ATACCTGCTGAAACTCTACTTGG + Intergenic
919118288 1:193308725-193308747 ACAGATGATGAAAGTGTAATAGG + Intergenic
919183865 1:194118923-194118945 TAAGCTTCTGAACCTGTACTGGG + Intergenic
921182453 1:212642338-212642360 AAAGATCCTGAAACCATAATTGG - Intergenic
922978425 1:229804119-229804141 CAAGCTGCAAAAACTGTAAGGGG + Intergenic
924109837 1:240687946-240687968 AAAGGTACTGAAACTTTATTTGG - Intergenic
924375145 1:243399861-243399883 AACGCTGCTTACCCTGTAATAGG + Intronic
1063028818 10:2210809-2210831 AGAGCTCCTGAGACTGTAAAGGG - Intergenic
1063476754 10:6335556-6335578 ATAGATGCTGAAACTGAAAAAGG + Intergenic
1063497022 10:6519621-6519643 TAAGCTGCTGAAACTGGCTTGGG - Intronic
1064526175 10:16259233-16259255 AAAGCTGGAGAAACTGGAAGAGG + Intergenic
1067565465 10:47332784-47332806 AACACTCCTGAAACTGTATTTGG - Intergenic
1068161795 10:53273706-53273728 AAAGCTGCTGTTAATCTAATAGG - Intergenic
1068340192 10:55691679-55691701 AAATCTGCTGATAATCTAATGGG + Intergenic
1069466746 10:68646680-68646702 CAACCTGCTGAAACCGTATTTGG - Exonic
1071721893 10:88155083-88155105 AAGGCTGCTTCTACTGTAATAGG + Intergenic
1074094558 10:110299223-110299245 AAAGCTGCTTAAAGTGTTTTGGG - Intronic
1075592084 10:123699221-123699243 AAAGCTGCTGTAACTGGGAATGG + Intergenic
1076090450 10:127681021-127681043 AAAGCTGCTGAAACCACAATTGG - Intergenic
1076517094 10:131052268-131052290 AAAGGTGTTGAAACTGCAATAGG + Intergenic
1076620640 10:131785188-131785210 ACAGCTGCTGCATCTGTAAATGG - Intergenic
1078174499 11:8959510-8959532 AAAGCTTCTGAAGCTGAAGTAGG - Intronic
1079935626 11:26612854-26612876 AAATCTGCTGATAGTCTAATAGG + Intronic
1081302518 11:41469722-41469744 AAAGCTGCTGAAACTTTTCTTGG - Intergenic
1081356318 11:42118671-42118693 ACAGCTCCTGAAAATGTTATTGG - Intergenic
1081383417 11:42443572-42443594 AAAGCTGCACAAACAGTGATTGG - Intergenic
1084345076 11:68541695-68541717 AAAGCTTCTGAAACTGGAGATGG + Intronic
1086540569 11:87905079-87905101 GAAGCTACTCAAACTGAAATAGG - Intergenic
1087282404 11:96226252-96226274 TTACCTGCTAAAACTGTAATTGG - Intronic
1088583842 11:111341472-111341494 AAACCTGTTGAAATTATAATTGG - Intergenic
1088988106 11:114927727-114927749 AGAGCTGCAGAAAATGGAATCGG + Intergenic
1089004502 11:115079650-115079672 ATTCCTGCTGAAACTGGAATAGG + Intergenic
1089952149 11:122538231-122538253 AAATCTGCTGATAGTCTAATGGG - Intergenic
1090514471 11:127411202-127411224 AAAGCTCCTTAAACTGTTATGGG + Intergenic
1092407699 12:8232416-8232438 AAAGCGGCTAAAACTTTCATTGG - Intergenic
1094023732 12:25941192-25941214 AGAGCATCTGATACTGTAATTGG - Intergenic
1095052289 12:37565231-37565253 ATACTTGCTGAAACTGTCATAGG + Intergenic
1098119564 12:67221771-67221793 AAAGATGCTGGCACTGCAATTGG - Intergenic
1098634774 12:72768916-72768938 AAAGCTTCTGAGAATATAATTGG + Intergenic
1099174405 12:79403807-79403829 AAATCTGCTGAGTCTGTAAGTGG + Intronic
1100683776 12:96962002-96962024 AAATCTGCTGATAATCTAATAGG - Intergenic
1101384827 12:104247366-104247388 AATGCAGATAAAACTGTAATGGG - Intronic
1102190660 12:110985478-110985500 AAAGTAGGTGAAACTGTAAGGGG - Intergenic
1102846374 12:116188708-116188730 AAAGTTGGTGAAACTATAAAAGG - Intronic
1103376980 12:120464374-120464396 AAAGATACTAAACCTGTAATGGG - Intronic
1103847332 12:123910607-123910629 AAATTTGTTGAAGCTGTAATGGG + Exonic
1104014529 12:124953177-124953199 TAAGCTGCTGCACCTGGAATGGG + Intronic
1104347732 12:128017325-128017347 ACATCTTCTGAAACTTTAATTGG + Intergenic
1105013853 12:132774044-132774066 AAACCTGCTGAAACTCTGCTGGG + Intronic
1105508049 13:21027802-21027824 AAACCTGCTGAGATTGTATTTGG + Intronic
1106902859 13:34372809-34372831 AAAGCAGCTGAAACTGACAGAGG + Intergenic
1107257542 13:38446709-38446731 AAAGCTGTTGAAACTGTTTTAGG - Intergenic
1107664787 13:42677641-42677663 AACCCTCCTGTAACTGTAATAGG + Intergenic
1109073888 13:57807655-57807677 AAATCTGTTGATACTCTAATGGG - Intergenic
1109982629 13:69928468-69928490 AATGCTGCTGTAATTTTAATAGG - Intronic
1110160056 13:72365978-72366000 AAAGCTGTTTAAACTTTAACTGG + Intergenic
1110565741 13:76956161-76956183 AAAGCTCCTAAAACTCTAAGAGG + Intronic
1111161458 13:84399736-84399758 TAAGCTGCTGACCCTGTAGTTGG + Intergenic
1111460249 13:88531142-88531164 AAAGCAGCTGAAACTCTATTAGG + Intergenic
1112215289 13:97424139-97424161 AAAGCTACTGAAATTTTAAGGGG + Intergenic
1112774465 13:102829087-102829109 ATAGCTTCTGAAACTCTGATAGG - Intronic
1113989631 13:114350610-114350632 AAAACTGCCGAAATTTTAATGGG + Intergenic
1114667561 14:24388819-24388841 AAGGCTGCTGCAGCTGTGATAGG + Intergenic
1115056282 14:29131813-29131835 AAAGATTCTAAAACTGTAATTGG + Intergenic
1115905494 14:38198750-38198772 AAATATGCTGAAACCGTAAATGG + Intergenic
1117176066 14:53148074-53148096 AAAGCATCTGAAACTGAAAATGG + Intronic
1119084577 14:71728024-71728046 AAAGAGGCTGAAACTAGAATTGG + Intronic
1120330341 14:83084961-83084983 AATGTTGGTGTAACTGTAATGGG - Intergenic
1121479024 14:94245808-94245830 CAAGCTGTTCAAACTCTAATAGG - Intronic
1123954538 15:25321309-25321331 AAAGCCACTGAATCTGTATTGGG + Intergenic
1124967210 15:34443727-34443749 AAAGTTTCTGAAAATGTACTGGG + Intergenic
1125029150 15:35059152-35059174 AAAACTGCTGAAACTCGAAGTGG - Intergenic
1125047669 15:35261167-35261189 AAAGCTGGTGAAACTGCATAAGG - Intronic
1125468085 15:39974894-39974916 AAAGGTGCAGAAACAGTAATGGG - Intronic
1125813289 15:42561099-42561121 AAAGTTGTTGAAAATGAAATTGG + Intronic
1126334211 15:47569065-47569087 AAAGCTTTTCAAACTGAAATGGG - Intronic
1128047944 15:64635679-64635701 AAAGCTGCTGTAACAATGATAGG + Intronic
1132356975 15:101178968-101178990 AAAGCTGCTGCATCTGTTACAGG + Exonic
1133656665 16:7871608-7871630 AAAGTTGCTAACACTGTGATCGG - Intergenic
1133842016 16:9418485-9418507 AAAGCTGCTGAAAAGGAAACAGG - Intergenic
1136502299 16:30678098-30678120 AAAGCTGCTGCAAATGAAAAAGG + Intergenic
1136998265 16:35206774-35206796 CACGCTGTTGAAACTGTCATAGG - Intergenic
1139901014 16:70328761-70328783 AAAAATGCTGAAAAGGTAATGGG - Intronic
1140155726 16:72425036-72425058 AAAGCGACTGATACTGTAGTTGG - Intergenic
1141746017 16:85926724-85926746 ACAGCTGCATAAACTGGAATGGG + Intergenic
1143604192 17:7971998-7972020 AAAGCCCCTGAATCTGTAGTGGG + Intergenic
1145372788 17:22321110-22321132 ATAGTTGCTGAAACTGTCATAGG + Intergenic
1148540081 17:48473317-48473339 AAGGCAGCTGCAACTGGAATGGG - Intergenic
1150498539 17:65628214-65628236 GAAGCTGCTGAAATAGAAATGGG - Intronic
1150927918 17:69553559-69553581 CAAGCTGCAGACACTGTAACTGG + Intergenic
1151101755 17:71563776-71563798 AAAGCCGGTAAAACTGCAATTGG - Intergenic
1153485625 18:5594860-5594882 AAAACTATTGAAATTGTAATAGG + Intronic
1156764566 18:40636267-40636289 AAAGGTGAGGAAACTGTAAGAGG - Intergenic
1157192231 18:45591228-45591250 AATGCTTCTCCAACTGTAATGGG + Intronic
1158144873 18:54300942-54300964 AAAGCTGATAAAACTGCAAGGGG + Intronic
1159208792 18:65288164-65288186 AAATCAGCTGAAAATGAAATGGG - Intergenic
1160674582 19:383032-383054 TATGCTGCTGAAGCTGTAATAGG - Intergenic
1164388936 19:27800570-27800592 ATTGGTGCTGAAACTGTACTGGG - Intergenic
1164979124 19:32599888-32599910 TAAGCTGCTTCAATTGTAATTGG - Intronic
1165356415 19:35306972-35306994 GAAGCTGCGGAAACTGTTATGGG - Intronic
1165376210 19:35444379-35444401 AAAGATGCTTAACCTGTAAGAGG + Intronic
1165571681 19:36780561-36780583 AGAGTTGCCGAAACTGTCATAGG - Intergenic
1167398164 19:49245320-49245342 AAAGCCTCTCAAACTGCAATGGG - Intergenic
1167439208 19:49498800-49498822 TAGGGTGCTGAACCTGTAATAGG + Intronic
925982801 2:9190933-9190955 AAAGCTGCTGATACCCTAATAGG - Intergenic
927065450 2:19466363-19466385 AAACCTTCAGAAACTGGAATTGG + Intergenic
927123203 2:19988444-19988466 ATAGCTTCTCAAACTGTATTAGG - Intronic
927220732 2:20706560-20706582 AAACCTGTTTAAACTGTTATTGG + Intronic
927505508 2:23610905-23610927 AAAGCACCTGAAACTGTGCTTGG - Intronic
928213460 2:29341351-29341373 GAAGCTGATGAAACTGCAACTGG + Intronic
931566031 2:63616394-63616416 AAAGGGGCTGAAAATGGAATTGG + Intronic
931573237 2:63691689-63691711 AAACCAGCTGAGACTGTAAAAGG + Intronic
931580615 2:63768425-63768447 AAATCTGCTGAAATTTTGATAGG + Intronic
933611227 2:84437771-84437793 ATAGCAGCTGTAATTGTAATAGG + Intronic
935879561 2:107549737-107549759 AAAGCTTCTGAAATTTTGATTGG - Intergenic
937842976 2:126544878-126544900 AATGCTGCTGAAACAGTCGTTGG + Intergenic
938035474 2:128031272-128031294 TAAGCTCCTGAAACTGGCATAGG - Intergenic
938279994 2:130057018-130057040 AAAGCTCGTGGAATTGTAATGGG - Intergenic
938435390 2:131280419-131280441 AAAGCTCGTGGAATTGTAATGGG + Intronic
938760834 2:134424433-134424455 GAAACTGCTGAAACTGGGATTGG - Intronic
939860650 2:147416239-147416261 ATGTCTGCTGACACTGTAATAGG - Intergenic
941289166 2:163653557-163653579 AAAGAAGCTGAAACCATAATTGG - Intronic
942007431 2:171718881-171718903 AAAGAAGCTGAAACTGAAAGAGG + Intronic
942440467 2:176030169-176030191 AAAGCAGCAGAAAATGTAAATGG + Intergenic
943066753 2:183095470-183095492 AGGGCTGCTGCAATTGTAATAGG + Exonic
947517536 2:230820306-230820328 AAACCTGCTGAAACAGCAATTGG - Exonic
1169423985 20:5482148-5482170 AGACCTGCTGAAACTGTCCTAGG + Intergenic
1169579781 20:7007320-7007342 AAAGCTGCTGGAATTTTGATAGG + Intergenic
1173357311 20:42306151-42306173 AAATCTGTAGAAACTGTAAGTGG + Intronic
1173359478 20:42328827-42328849 AGAGCTATTGCAACTGTAATAGG + Intronic
1173729598 20:45319024-45319046 CCAGCTGCTGAAACTGTCCTTGG + Intergenic
1174222696 20:48969997-48970019 AATGCTGCTAATACTGTGATAGG + Intronic
1174895383 20:54443982-54444004 ACAGCTGTTGAAAATGTTATTGG - Intergenic
1178143549 21:29712765-29712787 AAAGTATCTGCAACTGTAATTGG - Intronic
1178283244 21:31302868-31302890 AAATCTCCTGAAACAGCAATTGG + Intronic
1178477683 21:32951563-32951585 AAAAATTCTGAAACTGTATTTGG + Intergenic
1179138286 21:38699685-38699707 AAACTTGCTGAAACCTTAATAGG + Intergenic
1179516839 21:41914439-41914461 AAAGCACCTGAAAATGTAACGGG - Intronic
1180925596 22:19552009-19552031 AAAGCTGTTGAAACTTTGATAGG + Intergenic
1182416923 22:30227189-30227211 AAAGCTGCTGAAGATGTTAAAGG + Intergenic
1183808574 22:40234542-40234564 AATGCTTCTCAAACTTTAATGGG - Intronic
951302528 3:21016257-21016279 AAATCTGCTGATAATCTAATAGG + Intergenic
953696029 3:45160211-45160233 AAAGCTGATGATACTTTAAATGG + Intergenic
955507906 3:59650355-59650377 AAAGCTGCTGTTAATCTAATAGG - Intergenic
955513678 3:59706372-59706394 AAAGTTGCTTCAACTGAAATGGG + Intergenic
955518228 3:59749243-59749265 AAAGTAACTGTAACTGTAATAGG + Intergenic
958270120 3:91489282-91489304 AAAGCAGCTGGAACTTAAATTGG + Intergenic
959210954 3:103379861-103379883 AATGCTGCTGCAAATTTAATGGG - Intergenic
959244014 3:103839837-103839859 AAAACTCCTGAAAGAGTAATGGG - Intergenic
959589719 3:108065015-108065037 AAAGCTTCTGAAACTGGTACTGG + Intronic
960141261 3:114153803-114153825 AAAGGTGCTGAGACTAGAATGGG - Intronic
962551293 3:136494924-136494946 AAAGCTTCTGAAATTATCATAGG - Intronic
962921179 3:139952028-139952050 AAAGTTGCTGAAACTCTCTTAGG - Intronic
963685186 3:148424414-148424436 AAGGCTGCTGAAATTTTGATAGG - Intergenic
964274001 3:154988617-154988639 AAATCTGCTGTTAGTGTAATGGG - Intergenic
965738857 3:171851600-171851622 CAAACTGATGAAACTGTAAATGG - Intronic
966135940 3:176698198-176698220 ACAGCTTCTCAAACTGGAATGGG + Intergenic
966201436 3:177362440-177362462 AATGCTTCTTAAACTGTCATGGG + Intergenic
966699012 3:182824272-182824294 AAAGCAGCTGGAAATGTAAAGGG - Intronic
967546416 3:190734283-190734305 AAAGTTGCTTACAATGTAATGGG - Intergenic
970312223 4:14794426-14794448 AAATCTGCTGTTAATGTAATGGG - Intergenic
970783256 4:19765808-19765830 AAAGCTGCTATTAGTGTAATGGG + Intergenic
971128679 4:23781837-23781859 ACAGCTGCCTAAACTGTAATAGG + Intronic
974400439 4:61397873-61397895 ATAGCTGTTGAAAATATAATGGG + Intronic
977941006 4:102859266-102859288 AAACCTGCTGAAAGTCTTATAGG + Intronic
978612683 4:110561113-110561135 AAAGCAGCAGAAACAGAAATGGG + Intronic
981019837 4:140013949-140013971 AGAACAGCTGAAAGTGTAATGGG - Intronic
982250857 4:153405093-153405115 AAAGCAGCTGAAATTTTGATAGG - Intronic
982738852 4:159036808-159036830 AAAGCTTCTGAAACTGTAGCAGG - Intronic
983991896 4:174129823-174129845 AAAGGTGCTGAAGCAGCAATCGG + Intergenic
984070291 4:175103069-175103091 AAACCTGCTGAAATTTTGATAGG + Intergenic
985200239 4:187477095-187477117 AAAGCTGCAGAAAGTGTGTTAGG + Intergenic
986597739 5:9441159-9441181 ACAGCTCCTGAGAGTGTAATAGG - Intronic
987769223 5:22278489-22278511 AAATCTGCTGAAAGAGGAATAGG + Intronic
987814074 5:22878249-22878271 AATACTGTTGAAAATGTAATGGG + Intergenic
988039982 5:25876547-25876569 AAAGCCAGTGGAACTGTAATGGG - Intergenic
993173654 5:84453514-84453536 AAATCTACTGAAATTGTATTGGG - Intergenic
995839351 5:116428924-116428946 TAAGCTGCTCAACCTGTAAGTGG + Intergenic
996041022 5:118811139-118811161 AAAGCTGGTGATAATCTAATGGG - Intergenic
996901285 5:128544431-128544453 AAAGCTGCTGAAAAATTACTTGG + Intronic
997026458 5:130068288-130068310 AAATCCTCTGAAACTGAAATGGG - Intronic
997320227 5:132971975-132971997 AAAGTTGCTGAAATTGTTAGAGG + Intergenic
997801955 5:136872492-136872514 ATAGGTGCTGAAACTGGATTAGG + Intergenic
998000482 5:138621232-138621254 AAAGCTGGTGAAACACAAATAGG + Intronic
999182384 5:149679072-149679094 AAAGTTGCTGAAACTATAGGAGG - Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1001776736 5:174334533-174334555 AAAGAGGCTGAAACAGGAATAGG - Intergenic
1003033488 6:2623029-2623051 AAAGCTCTGGAAACTGTGATGGG - Exonic
1003481226 6:6535129-6535151 AAAGCTGCTGAAACTGTAATTGG + Intergenic
1003715604 6:8642903-8642925 CAAGCAGCTGGAAGTGTAATGGG + Intergenic
1003829024 6:9985543-9985565 ATGGCTGCTAAAAATGTAATTGG - Intronic
1004305177 6:14494346-14494368 AAACCTGCTGAAATTTTTATTGG + Intergenic
1006841316 6:37029577-37029599 AAAGCTGCTGGGCCTGTGATGGG - Intergenic
1007482900 6:42161893-42161915 CAAGGAGCTGAAACTCTAATGGG + Intronic
1007851612 6:44808168-44808190 CAATTTGCAGAAACTGTAATTGG - Intergenic
1008464184 6:51812202-51812224 AATGGTACTGAAACTCTAATAGG - Intronic
1008751895 6:54745029-54745051 AAATCTGCTGATAGTCTAATGGG + Intergenic
1008972456 6:57385569-57385591 AAAACTGGTGAAACTTGAATGGG - Intronic
1008985039 6:57532056-57532078 AAAGCAGCTGGAACTTAAATTGG - Intronic
1009161364 6:60287096-60287118 AAAACTGGTGAAACTTGAATGGG - Intergenic
1009173075 6:60425012-60425034 AAAGCAGCTGGAACTTAAATTGG - Intergenic
1009490004 6:64278104-64278126 ACAGCAGTTGAAAATGTAATTGG + Intronic
1009510223 6:64541336-64541358 AAGGCTGCTGGGACTATAATAGG - Intronic
1009550166 6:65080976-65080998 CTACCTGCTGAGACTGTAATGGG - Intronic
1010243954 6:73645395-73645417 ACAGATGCTGCAACTGTCATAGG - Intronic
1010431833 6:75786423-75786445 AAATCTGTTGAAATTTTAATTGG + Intronic
1013024257 6:106254114-106254136 TAGGCTGCTAAAACTGAAATGGG - Intronic
1013200038 6:107885603-107885625 AAAGCTGCTGAAATTTACATTGG - Intronic
1013816803 6:114108860-114108882 AAAGCTGTTAAAAATGTAACTGG + Intronic
1014383458 6:120773095-120773117 AAATCTGAGTAAACTGTAATTGG - Intergenic
1014602016 6:123424944-123424966 AAAGCTGCTGAAATTTTCAGGGG + Intronic
1014628239 6:123756480-123756502 AAAGCTCCTGAAAAAGAAATTGG - Intergenic
1015231437 6:130919587-130919609 AAAATTACTGAAGCTGTAATAGG - Intronic
1018467012 6:164057359-164057381 AAAACTGTTGAAAATGTGATTGG - Intergenic
1018601693 6:165550761-165550783 AAGGCTTCTGTAACTGGAATGGG + Intronic
1018703599 6:166447259-166447281 ACAGTTCCTGGAACTGTAATTGG - Intronic
1020570265 7:9851369-9851391 AAAGCTCATGAAAGTGAAATGGG + Intergenic
1021862975 7:24925430-24925452 AAAGATGGGGAAACTGTATTGGG - Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1027770445 7:82399833-82399855 AAAGGTGCCTAAACTATAATAGG + Intronic
1028226029 7:88253812-88253834 AAATCTGCTGATAGTCTAATGGG + Intergenic
1028351408 7:89854408-89854430 AAACCTGATAAAACAGTAATTGG + Intergenic
1028838677 7:95402223-95402245 AAAACAACTGAAACTGTAATTGG - Intergenic
1028840287 7:95422211-95422233 AAAGCTGCTCACACTGTTTTAGG + Intronic
1030846815 7:114426405-114426427 AAAGATGCTGTCTCTGTAATTGG + Intronic
1031480310 7:122270214-122270236 AATTCTGCTGGAACTATAATCGG - Intergenic
1034237299 7:149582376-149582398 AGAGGAGCTGAAACAGTAATGGG - Intergenic
1034909132 7:154978407-154978429 ATAGCTGTTGGAAGTGTAATTGG - Intronic
1034942778 7:155242333-155242355 AAAACTGCTGATCCTGAAATAGG - Intergenic
1036527859 8:9551975-9551997 AAAGCTACTAAAACTTTAATGGG + Intergenic
1036987307 8:13549461-13549483 ACAGATGGTGAAAATGTAATTGG - Intergenic
1037218654 8:16488989-16489011 ACAGATGCTGAAACTCTAAGTGG - Intronic
1037615481 8:20515154-20515176 AAAGCAGGTGAATCTGAAATGGG + Intergenic
1038811264 8:30847916-30847938 AAAGCTAATGGAACTGAAATTGG - Exonic
1039802471 8:40971308-40971330 AAAGCTGCTTAAACTTTCATAGG + Intergenic
1040506895 8:48057148-48057170 AAAGCAGTTGAAATTTTAATAGG + Intronic
1040748807 8:50680403-50680425 ATAGCTGATGAAGCTGTAGTTGG + Intronic
1041940244 8:63379490-63379512 AAAGTTACTGAAATTTTAATAGG + Intergenic
1042120114 8:65478060-65478082 ACACCTGCTGAAAATGGAATGGG + Intergenic
1042944620 8:74142708-74142730 AAAGCTTCTGAAATAGTATTTGG + Intergenic
1043341900 8:79249938-79249960 AAAGGTGATGTCACTGTAATTGG + Intergenic
1043423791 8:80128040-80128062 ATAGCTGCTGAAAATGTCAAAGG + Intronic
1044835459 8:96291245-96291267 AAAGCTGTTGAAATTGTCTTAGG - Intronic
1045073337 8:98534660-98534682 AAATCTGCTGAAAATGTTAATGG - Intronic
1045553290 8:103191870-103191892 AAAGCTGCAGAGACAGGAATGGG + Intronic
1045613567 8:103877770-103877792 AAGGATGCTGATACTTTAATAGG + Intronic
1045989118 8:108285150-108285172 AAGAATGCTGAAACTGTAGTTGG + Intronic
1045999824 8:108406251-108406273 ATAGCTGCTGTGGCTGTAATAGG - Intronic
1047010729 8:120669755-120669777 AATGCTTGTTAAACTGTAATGGG + Intronic
1047366074 8:124212759-124212781 AAAGCTGTTAAAACTGTATGTGG + Intergenic
1047938391 8:129803810-129803832 AAAGTTGCTGTGACTGAAATAGG - Intergenic
1048053237 8:130839196-130839218 AAGGCTGCTGAAGGTATAATAGG + Intronic
1050129524 9:2396864-2396886 ATAGCTGCTGAAACTATGTTGGG - Intergenic
1050498914 9:6273358-6273380 AAAGTTTCTCAAACTGTTATTGG - Intergenic
1050822421 9:9896413-9896435 CAAGCAGCTGAAACTGGAACAGG + Intronic
1052602217 9:30648478-30648500 AAACCTGGAGAAATTGTAATAGG - Intergenic
1058960904 9:109991962-109991984 AAAGTTGCTAAAAATGGAATGGG + Intronic
1059984527 9:119809168-119809190 AAAACAGCTGAAATTGTAAAAGG - Intergenic
1185819811 X:3191509-3191531 AAAACTGATGCAAATGTAATGGG - Intergenic
1186045894 X:5536306-5536328 TAAGCTGCTGAAACTGGCTTGGG - Intergenic
1186804478 X:13126346-13126368 AAAGTTCCTCAAGCTGTAATGGG - Intergenic
1188033697 X:25293082-25293104 AAAGCATCTAAAAATGTAATAGG - Intergenic
1188339207 X:28978034-28978056 AATGGAGCTGAAACTGTAAGTGG + Intronic
1188659988 X:32747330-32747352 AAAGCTACTCAAACTTTAGTTGG + Intronic
1188970131 X:36605300-36605322 AAAGCTGGTGTAACTATAACAGG - Intergenic
1188989885 X:36804831-36804853 AGAGCTGCAGACACTGTGATTGG + Intergenic
1189019146 X:37316571-37316593 AATCCTGTTGAAACTGGAATTGG + Intergenic
1189869471 X:45367329-45367351 AAAGCTTCTGTAACTGCAACTGG - Intergenic
1192286953 X:69748273-69748295 ACACCTGTTGAATCTGTAATAGG + Intronic
1192489625 X:71564357-71564379 AAAGCTGTTGGAACGTTAATAGG + Intronic
1193605160 X:83558194-83558216 AAGGCTGTTGAAATTTTAATAGG + Intergenic
1196135486 X:112205062-112205084 GAAGCTGTTGAAACTATAAGTGG - Intergenic
1196793545 X:119485067-119485089 AAAGCTGTTGTAACTGAAAGAGG + Intergenic
1197339922 X:125255022-125255044 AATGCTGCAGAAACTGCAGTGGG - Intergenic
1198107452 X:133475030-133475052 AATGTTGCTAACACTGTAATGGG - Intergenic
1198145396 X:133851313-133851335 AACTCTGGTGAAAGTGTAATTGG - Intronic
1200626976 Y:5530834-5530856 AAAGATTGTGAAACTGTTATAGG + Intronic
1200847857 Y:7850294-7850316 AGAGCTGCTGCAACTGCAATAGG - Intergenic
1201426972 Y:13862171-13862193 ACAGCTGCTGAAACTGTTGCAGG + Intergenic
1201528960 Y:14970779-14970801 AAAGCTGCTGACACTGGACTGGG + Intergenic