ID: 1003481996

View in Genome Browser
Species Human (GRCh38)
Location 6:6543010-6543032
Sequence CTGCGCTGCACCTTGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003481988_1003481996 30 Left 1003481988 6:6542957-6542979 CCCATAAATTCCTCAGGGAGTAC No data
Right 1003481996 6:6543010-6543032 CTGCGCTGCACCTTGCCAGCTGG No data
1003481990_1003481996 20 Left 1003481990 6:6542967-6542989 CCTCAGGGAGTACAGTTACTTCC No data
Right 1003481996 6:6543010-6543032 CTGCGCTGCACCTTGCCAGCTGG No data
1003481989_1003481996 29 Left 1003481989 6:6542958-6542980 CCATAAATTCCTCAGGGAGTACA No data
Right 1003481996 6:6543010-6543032 CTGCGCTGCACCTTGCCAGCTGG No data
1003481991_1003481996 -1 Left 1003481991 6:6542988-6543010 CCTTGATGCAATAGCACCTCCCC No data
Right 1003481996 6:6543010-6543032 CTGCGCTGCACCTTGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003481996 Original CRISPR CTGCGCTGCACCTTGCCAGC TGG Intergenic
No off target data available for this crispr