ID: 1003482463

View in Genome Browser
Species Human (GRCh38)
Location 6:6546250-6546272
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003482456_1003482463 26 Left 1003482456 6:6546201-6546223 CCTTCGGATGAACAGCCGGGTGA No data
Right 1003482463 6:6546250-6546272 CGCCTGTCCGCGGCCTAGATGGG No data
1003482457_1003482463 11 Left 1003482457 6:6546216-6546238 CCGGGTGAATCGCCATGAAAAAT No data
Right 1003482463 6:6546250-6546272 CGCCTGTCCGCGGCCTAGATGGG No data
1003482458_1003482463 -1 Left 1003482458 6:6546228-6546250 CCATGAAAAATTAATCAGCCTCC No data
Right 1003482463 6:6546250-6546272 CGCCTGTCCGCGGCCTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003482463 Original CRISPR CGCCTGTCCGCGGCCTAGAT GGG Intergenic
No off target data available for this crispr