ID: 1003483278

View in Genome Browser
Species Human (GRCh38)
Location 6:6552773-6552795
Sequence CAGAGGAAACAGAATGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003483273_1003483278 22 Left 1003483273 6:6552728-6552750 CCACAACGAAATAGCCATTATGT No data
Right 1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG No data
1003483272_1003483278 23 Left 1003483272 6:6552727-6552749 CCCACAACGAAATAGCCATTATG No data
Right 1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG No data
1003483274_1003483278 8 Left 1003483274 6:6552742-6552764 CCATTATGTTTTCACTAACAGAA No data
Right 1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003483278 Original CRISPR CAGAGGAAACAGAATGAAAG GGG Intergenic
No off target data available for this crispr