ID: 1003485095

View in Genome Browser
Species Human (GRCh38)
Location 6:6568797-6568819
Sequence TGCTTCACAGCTACTTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003485095_1003485103 29 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485103 6:6568849-6568871 TGCATGGACAAAGGTGGAGGTGG No data
1003485095_1003485100 20 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485100 6:6568840-6568862 AGGAAGAACTGCATGGACAAAGG No data
1003485095_1003485101 23 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485101 6:6568843-6568865 AAGAACTGCATGGACAAAGGTGG No data
1003485095_1003485099 13 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485099 6:6568833-6568855 GAAGTCAAGGAAGAACTGCATGG No data
1003485095_1003485102 26 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485102 6:6568846-6568868 AACTGCATGGACAAAGGTGGAGG No data
1003485095_1003485104 30 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485104 6:6568850-6568872 GCATGGACAAAGGTGGAGGTGGG No data
1003485095_1003485098 0 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485098 6:6568820-6568842 GAGGAAAGGCAAAGAAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003485095 Original CRISPR TGCTTCACAGCTACTTTCCG TGG (reversed) Intergenic
No off target data available for this crispr