ID: 1003485104

View in Genome Browser
Species Human (GRCh38)
Location 6:6568850-6568872
Sequence GCATGGACAAAGGTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003485095_1003485104 30 Left 1003485095 6:6568797-6568819 CCACGGAAAGTAGCTGTGAAGCA No data
Right 1003485104 6:6568850-6568872 GCATGGACAAAGGTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003485104 Original CRISPR GCATGGACAAAGGTGGAGGT GGG Intergenic
No off target data available for this crispr