ID: 1003488142

View in Genome Browser
Species Human (GRCh38)
Location 6:6597249-6597271
Sequence CTGGCTGCACTACTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003488142_1003488151 22 Left 1003488142 6:6597249-6597271 CCCAGCTCCAGTAGTGCAGCCAG 0: 1
1: 0
2: 3
3: 17
4: 181
Right 1003488151 6:6597294-6597316 CACCAGGTGCCCCATGAGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 229
1003488142_1003488150 18 Left 1003488142 6:6597249-6597271 CCCAGCTCCAGTAGTGCAGCCAG 0: 1
1: 0
2: 3
3: 17
4: 181
Right 1003488150 6:6597290-6597312 ACAGCACCAGGTGCCCCATGAGG 0: 1
1: 0
2: 1
3: 21
4: 181
1003488142_1003488148 6 Left 1003488142 6:6597249-6597271 CCCAGCTCCAGTAGTGCAGCCAG 0: 1
1: 0
2: 3
3: 17
4: 181
Right 1003488148 6:6597278-6597300 TGGCAGAACCTGACAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003488142 Original CRISPR CTGGCTGCACTACTGGAGCT GGG (reversed) Intronic
900934268 1:5755447-5755469 CCGGCAGCACTTCTGAAGCTGGG + Intergenic
902877384 1:19349152-19349174 CTGTCTGCTCAACAGGAGCTGGG + Intronic
904419113 1:30380043-30380065 CTGCCTACACTGCAGGAGCTAGG + Intergenic
904419173 1:30380345-30380367 CTGCCTGTACTACAGGAGCTGGG + Intergenic
908653493 1:66362324-66362346 CTCCCTCCACTACTGGAGTTTGG - Intronic
909764198 1:79334341-79334363 CTGGCCCCATTACTGGAGCAAGG + Intergenic
911292685 1:96077070-96077092 CTGGCTCCTCCACTTGAGCTGGG + Intergenic
914331035 1:146671103-146671125 CTGGCTGCAGGACCAGAGCTCGG - Intergenic
915513723 1:156400913-156400935 TTGGCTGCACCACTGGATGTGGG + Intergenic
918497733 1:185158005-185158027 CTGGCTGCCCTGCTTGGGCTTGG + Intronic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
920688157 1:208125759-208125781 CTGGCTGCACAAATGGCCCTGGG + Intronic
922060632 1:222087686-222087708 CTGACTCTAGTACTGGAGCTCGG + Intergenic
922961265 1:229647579-229647601 CTGGCTGCACTGCTGCGGCAGGG + Exonic
923048163 1:230370380-230370402 TTGGCAACACTTCTGGAGCTGGG - Intronic
923621432 1:235582554-235582576 CTGTCTGCACTTCTGGAGCACGG + Intronic
1065612212 10:27483109-27483131 CTGGCTGCTCTCATGGAGCCAGG + Intergenic
1066392119 10:34986015-34986037 CTGGGTCCATTGCTGGAGCTGGG - Intergenic
1067358913 10:45558629-45558651 GTGGCTGCACTTCTGGTGCCAGG + Intronic
1067753364 10:48986066-48986088 CTGGCGGGACTTGTGGAGCTGGG - Intergenic
1067959702 10:50834325-50834347 CGGGCTGGAATACTGGAGGTAGG + Intronic
1069185270 10:65414542-65414564 CTGGGAGCACTACAGGAGATCGG + Intergenic
1075668077 10:124244803-124244825 CTGCCTGGACCCCTGGAGCTTGG + Intergenic
1076706695 10:132306183-132306205 CTGGCTGCTCTTCTGGGTCTCGG - Intronic
1077111348 11:863557-863579 GTGGCAGCCCTACTGGGGCTTGG + Intronic
1077168993 11:1158087-1158109 CTGGCCGCTCTACTGGTCCTGGG + Intronic
1077411319 11:2405208-2405230 CTGCCTGCACTCCTGGGACTAGG + Intronic
1077511306 11:2965020-2965042 CTGCCTGCAATACTGGGGCAAGG + Intronic
1078016198 11:7617245-7617267 CTGGCTGCAGGGCTGGGGCTCGG - Intronic
1080551547 11:33376853-33376875 CTGGCGGCCCTCCTGGAGCACGG + Intergenic
1080659509 11:34284763-34284785 CTGGCTGCAGTGCTGGACTTGGG - Intronic
1080739392 11:35049542-35049564 CTGACTGCCCTACTGGATTTTGG + Intergenic
1080843978 11:36010147-36010169 CTGCCTGCACCATTGGAGCAAGG - Intronic
1083328593 11:61886258-61886280 CTGGCTCCACTACTGGAGCCTGG + Intronic
1083421770 11:62557285-62557307 CTGGCTGCTCATCTTGAGCTGGG - Intergenic
1084278137 11:68066915-68066937 CTGGCTGCAGCACTCCAGCTGGG + Intronic
1084288216 11:68145581-68145603 CTGGCTGCCCCACTGGGGGTGGG + Intergenic
1085620800 11:78036758-78036780 CTGGCTGCCCTCATGGAGCTTGG - Intronic
1087009444 11:93499498-93499520 CTGTCTGCCCTTCTGGAGCAGGG - Intronic
1088014099 11:105038055-105038077 TTGGCTGCCCTACTGGATATTGG + Intergenic
1090759631 11:129825067-129825089 CTGACTACACTACTGGAGGATGG - Intronic
1091318975 11:134636343-134636365 CTGGTTGCATTGCTGGGGCTCGG + Intergenic
1093459499 12:19395547-19395569 ATTGCTGCACAACTGGAGCAGGG - Intergenic
1096275306 12:50202207-50202229 CTGGCAGCAGTTCTGGAGGTGGG - Intronic
1096646934 12:53043909-53043931 CTGGGTCCACTCCTGCAGCTGGG - Intergenic
1096948779 12:55441388-55441410 CTGGGAGCACTACTGGAGACCGG + Intergenic
1098972001 12:76866942-76866964 CTGGCTGCACTAGTGGGCCTTGG - Intronic
1101862389 12:108493718-108493740 GGGGCTGCCCTGCTGGAGCTGGG - Intergenic
1102883803 12:116506766-116506788 CTGGCATCACTACTGCTGCTCGG + Intergenic
1104128176 12:125867253-125867275 CCAGCTGCACTCCTGGAGCTGGG + Intergenic
1104391833 12:128397436-128397458 CTTGCTACACTGCTGCAGCTGGG - Intronic
1105328382 13:19391148-19391170 CTGGCTGCACAACAGAAGGTGGG + Intergenic
1106125257 13:26895810-26895832 CTGGCTTCACTGCTGTAGCCCGG + Intergenic
1106901246 13:34356848-34356870 CAGGCAGCACTTCTGCAGCTTGG + Intergenic
1109436685 13:62312684-62312706 CTGGCTGCACAACTAGAAATTGG + Intergenic
1111950064 13:94703025-94703047 CTCGCCTCACCACTGGAGCTGGG + Intergenic
1113469397 13:110533823-110533845 CTGGGTGCATGAATGGAGCTGGG + Intronic
1113660401 13:112103613-112103635 CTGACTCCTCTACTGGAGCGAGG + Intergenic
1113800951 13:113085972-113085994 CTGCCTGCCCTCCTGCAGCTGGG - Intronic
1119435694 14:74596510-74596532 CAGGCTGCACTCAGGGAGCTGGG + Intronic
1121577056 14:94996958-94996980 CTGCCTGCAGTACTGGAGCTGGG + Intergenic
1122027165 14:98886453-98886475 CTCTCTGCCCTCCTGGAGCTTGG + Intergenic
1122128408 14:99591483-99591505 CTGGCTGGACTACAGGATGTGGG - Intronic
1122264553 14:100540526-100540548 CTGGCTGCACTGCAGCAGCTGGG + Exonic
1122556972 14:102585738-102585760 CTGGCTGCAAGGCTGGAGTTAGG + Intergenic
1123189192 14:106551566-106551588 ATGGCTGCCCTACTGGTGTTTGG + Intergenic
1123986465 15:25650614-25650636 CTGGCTTCACTGCTTGAGCTGGG + Intergenic
1124579128 15:30937173-30937195 CTGGCTGAACTGCAGAAGCTGGG + Exonic
1126850890 15:52796149-52796171 CTAGCTGCACCCCTGGACCTTGG - Intergenic
1128054796 15:64691543-64691565 GTGCCTGCAGCACTGGAGCTGGG + Exonic
1128633917 15:69290918-69290940 CTGGCTGCTCTCCTGGGGCCTGG - Intergenic
1128676423 15:69612407-69612429 CTGGCTGGAATGGTGGAGCTGGG - Intergenic
1129713361 15:77832794-77832816 CTGGCTCCACCACTGGATCTGGG + Intergenic
1129904268 15:79175072-79175094 ATGACTGCACGGCTGGAGCTGGG + Intergenic
1130527016 15:84716126-84716148 CGGGCGGAACTACTGGAGCTCGG + Intronic
1130873622 15:87992979-87993001 CAGGCTGCACTACAGTATCTTGG + Intronic
1133773655 16:8882311-8882333 ATGGCTGTTCTACTGGAGCCAGG + Intergenic
1135390903 16:22092469-22092491 CAGACTGCACCACTGCAGCTCGG - Intergenic
1136514572 16:30760427-30760449 CTGGCTGAGCTGCTGGAGCTAGG - Exonic
1137939512 16:52669809-52669831 CTGGCTGCAATACCTGTGCTGGG - Intergenic
1140002518 16:71039801-71039823 CTGGCTGCAGGACCAGAGCTCGG + Intronic
1140023998 16:71267011-71267033 CTGGCTTCAACTCTGGAGCTGGG + Intergenic
1141330039 16:83102549-83102571 CTGGCTTCACTCCAGGTGCTAGG + Intronic
1143795335 17:9331501-9331523 GTGGCTGCAGTAATGAAGCTGGG + Intronic
1143810959 17:9471498-9471520 CTGGCTGGCATCCTGGAGCTTGG + Intronic
1144574060 17:16417909-16417931 CCGGGTGCTCTGCTGGAGCTGGG - Intronic
1144645508 17:16970995-16971017 CTGTCTGCACTAAAGGACCTGGG + Intronic
1146141153 17:30369088-30369110 CTGCCAGCACCACTGGCGCTGGG + Intergenic
1147305022 17:39557181-39557203 CTGGCTGGACTTCTACAGCTGGG + Intronic
1148965887 17:51435769-51435791 CTGGCTGTACATCTAGAGCTTGG - Intergenic
1152085112 17:78213363-78213385 CTGGAGTCACTTCTGGAGCTGGG - Intergenic
1152768658 17:82154417-82154439 CTTCCTGCACTACAGGAGGTAGG + Intronic
1153684132 18:7528430-7528452 CTAGGTGCACTACTGAACCTGGG - Intergenic
1155036982 18:22033109-22033131 CTGGCAACACGACTGCAGCTGGG - Intergenic
1156263536 18:35466645-35466667 CAGCCTGGACTTCTGGAGCTTGG + Intronic
1160965850 19:1746588-1746610 CTTGCTGCAGGCCTGGAGCTGGG + Intergenic
1161360680 19:3847859-3847881 CAGGCTCCACTCCTGGAGCCGGG + Intronic
1161581543 19:5083478-5083500 CTGGCTGCCTGTCTGGAGCTGGG + Intronic
1162478545 19:10915143-10915165 CTGGCTGTGCTCCTGGAGGTGGG + Intronic
1162492748 19:11003652-11003674 CTGGCTGCATTTCAGGTGCTTGG + Intronic
1163156552 19:15442809-15442831 CTGGCAGGGCTCCTGGAGCTGGG - Intronic
1168548242 19:57271694-57271716 CAGGCTGCAGTACTGTAGCAGGG - Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929534645 2:42773417-42773439 CTGGCTGCACTGGGGGAGGTGGG + Intronic
929685783 2:44032991-44033013 CTGGCAGTGCTACTGGAACTTGG - Intergenic
933210587 2:79563971-79563993 CAGGATGCATTACTGGAGCCTGG + Intronic
937624019 2:124024138-124024160 CTGGCTGCACGACTATAGATGGG - Intergenic
937985687 2:127637145-127637167 CTGCTTGCCCTGCTGGAGCTGGG - Intronic
938341485 2:130539405-130539427 CTGCCTGTCCTCCTGGAGCTGGG - Exonic
938348345 2:130581304-130581326 CTGCCTGTCCTCCTGGAGCTGGG + Intronic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
941099199 2:161278380-161278402 CTAGCTGCAATTCTGTAGCTAGG - Intergenic
942509638 2:176684218-176684240 ATCCCTGCACTACTGGGGCTTGG + Intergenic
942901894 2:181129885-181129907 CTGGGTGCAGTACAAGAGCTGGG + Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
946342393 2:219079201-219079223 CTGGCTGCACTTCGGAATCTTGG + Intronic
946366052 2:219249740-219249762 CTTGCTGCTTTGCTGGAGCTGGG - Exonic
947910255 2:233795986-233796008 CTGGCTGCTGTACTGATGCTGGG - Exonic
1171105402 20:22428482-22428504 CTGGCTCCACTATTAGAGATGGG - Intergenic
1171116554 20:22529798-22529820 CTGGCTTCTCAACTGGAGCTGGG + Intergenic
1174778152 20:53364527-53364549 CTGGCTGGACAAGTGGGGCTGGG - Intronic
1176038073 20:63049987-63050009 CTGGCGGCCCTTCTGGAGCCTGG + Intergenic
1177588846 21:23135454-23135476 CTGGGAGCACTACTGGAGAGTGG + Intergenic
1177606094 21:23379376-23379398 TTGGCTGCCCTACTGGATTTTGG + Intergenic
1178710381 21:34911604-34911626 CTGGCTGCTTTACTGGAGTGGGG - Intronic
1180183601 21:46128864-46128886 CTGGAAGCCCTACTGGAGTTTGG + Intronic
1181534434 22:23534267-23534289 CTTGCTCCACTACTGGATCCTGG + Intergenic
1182756092 22:32680870-32680892 CAGCCTGCATTTCTGGAGCTGGG - Intronic
1184277032 22:43414829-43414851 CTGCCTGCCCTTCTGGAGCAAGG + Intronic
1185169695 22:49285616-49285638 CTGGCTGCTCCAGTGGAGCCTGG + Intergenic
1185380818 22:50506858-50506880 CTGGGTGCACTAGTGGCCCTGGG - Exonic
949652090 3:6171429-6171451 CTTGCTTCACTGCTTGAGCTGGG + Intergenic
952101858 3:30023034-30023056 CTGGCTGCACTATGGAAGATGGG + Intergenic
952414798 3:33081029-33081051 CTGGCTCCACCCCTGGAGCGGGG + Intronic
953096683 3:39783768-39783790 CTGGCTCCTCTCCTGCAGCTGGG + Intergenic
956848025 3:73201916-73201938 CTGGCTGCCATTCTGCAGCTGGG - Intergenic
957945403 3:87057205-87057227 CTGACTGCCCTGCTGGAGTTTGG - Intergenic
958966223 3:100561823-100561845 CTGGGGGGACTAGTGGAGCTGGG - Intronic
961477730 3:127159079-127159101 CTGGCTCCACCACTACAGCTGGG + Intergenic
971003202 4:22345823-22345845 GTGCCAGCACTGCTGGAGCTAGG + Intronic
973548412 4:52005814-52005836 CTGGCTGTAGTGCTGGAGCCAGG - Intronic
974846397 4:67355624-67355646 CTTGCTCCTCTGCTGGAGCTTGG - Intergenic
974888645 4:67851876-67851898 CTGGCAGCACTTCTGGCGCCTGG + Intronic
980107951 4:128606467-128606489 ATGACTGCACTACTGGAGTTAGG - Intergenic
982237673 4:153267204-153267226 AAGGCTGCACTACAGAAGCTTGG - Intronic
986081047 5:4394668-4394690 TTGGCTGCCCCACTGGATCTTGG - Intergenic
987016260 5:13822928-13822950 CTGGCTGCCTCTCTGGAGCTTGG - Intronic
987865394 5:23529308-23529330 CTGTCTGCCCTCCTCGAGCTTGG - Intergenic
990339627 5:54809443-54809465 CTGGGAGCACTACGGGAGATGGG + Intergenic
991566797 5:68013515-68013537 CAGGCTTCCCTACTTGAGCTGGG - Intergenic
991953235 5:71967081-71967103 CTGGCAGCAGTCCTGCAGCTGGG + Intergenic
994350678 5:98742597-98742619 CTTTTTGCACTACTGGTGCTGGG + Intergenic
997294240 5:132759949-132759971 TTGACTGCACTCCTGGTGCTGGG + Intronic
998399734 5:141842452-141842474 CTGACTGCAGGACTGGGGCTGGG + Intergenic
1001459704 5:171900486-171900508 TTGGCTTTACTACTGGAACTCGG + Intronic
1003050624 6:2777863-2777885 CAGGCTGCACCACTGGCTCTGGG + Intronic
1003116461 6:3286870-3286892 CTGGCCTCACTCCTGCAGCTCGG - Exonic
1003488142 6:6597249-6597271 CTGGCTGCACTACTGGAGCTGGG - Intronic
1004544418 6:16583610-16583632 CTTGCTGTACCACAGGAGCTAGG + Intronic
1005347382 6:24903981-24904003 CTGCCTTCCTTACTGGAGCTGGG + Intronic
1005899008 6:30201399-30201421 CTGGAAGCACTAATGGATCTAGG + Intronic
1007207885 6:40167367-40167389 ATGGCAGGAGTACTGGAGCTGGG + Intergenic
1007797509 6:44362097-44362119 CTGGCTGCACTAGGGGAACATGG - Intronic
1010294253 6:74177644-74177666 CTGGCTGCATATATGGAGCTGGG - Intergenic
1012739305 6:102994228-102994250 CTGGCTGGATTACTGGAGTCTGG - Intergenic
1015938860 6:138429839-138429861 CTGCCTGCTCTTCTGTAGCTGGG - Exonic
1018096431 6:160390930-160390952 CTGGCAGCAGTGCTGGAGCCAGG - Intronic
1019426592 7:980370-980392 CTGGCTGCTCAAGTGGAACTTGG - Intergenic
1027056352 7:75052563-75052585 CTGGCTGCACTCCTGCAGCGCGG - Intronic
1027871813 7:83717034-83717056 GTGGCTGCAAAACTGGAACTGGG - Intergenic
1028731012 7:94148521-94148543 CTGGCAGCACTCCTGGAGACTGG - Intergenic
1031564430 7:123277772-123277794 CTCTCTGCATCACTGGAGCTGGG + Intergenic
1032862905 7:135898511-135898533 CTAGCCTCACTACTTGAGCTGGG - Intergenic
1035296352 7:157868890-157868912 CTGGCCTCACCACTGGTGCTAGG - Intronic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1038429105 8:27485614-27485636 CTGGGTGCAGTACAAGAGCTTGG - Intergenic
1039802813 8:40974670-40974692 CTAGCTGCACGAGTGGGGCTGGG + Intergenic
1040512299 8:48105936-48105958 CTTGGTGCACTACTGGCCCTGGG - Intergenic
1044683255 8:94802698-94802720 CTGATTGCACCACTGCAGCTTGG - Intergenic
1044803716 8:95983348-95983370 CTGACTGTACCATTGGAGCTGGG - Intergenic
1046080247 8:109362517-109362539 CTGGCTCTAGTGCTGGAGCTCGG - Exonic
1047350153 8:124066130-124066152 CTGGATACAGTACAGGAGCTAGG - Intronic
1048974739 8:139664840-139664862 CTGGCTTCATTCCTGGAGCACGG + Intronic
1049578277 8:143399581-143399603 CTGGCTGCCCTCCTGGCACTGGG + Intergenic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1050914853 9:11118694-11118716 CAGGCTGTACTCCTGCAGCTTGG - Intergenic
1055234798 9:74107864-74107886 CTGCCTGCATTAGTGGACCTTGG + Intergenic
1058071118 9:100601488-100601510 CATGATGCACTACAGGAGCTGGG - Intergenic
1060782476 9:126422957-126422979 CTGGCTCCACTGCAGGAGCCAGG + Intronic
1061508050 9:131043258-131043280 CTGGCCGCACTGCTGGAGCTTGG - Intronic
1062000766 9:134214635-134214657 GTGGCTGAGCTACTGGAGATGGG + Intergenic
1185933412 X:4228773-4228795 CTGGCTGGTCTCATGGAGCTTGG + Intergenic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1189457721 X:41208412-41208434 CTCGCTGTGCTAGTGGAGCTCGG + Intronic
1190282921 X:48942928-48942950 CTGGCTGCACAACTGATTCTTGG - Intronic
1194886367 X:99320584-99320606 CTGGCTGCCCTGCTGAAGCTTGG + Intergenic
1195419075 X:104653435-104653457 TTCCCTGCACCACTGGAGCTAGG - Intronic
1195425069 X:104719582-104719604 TTGGGTGCATTGCTGGAGCTAGG + Intronic
1200699640 Y:6391152-6391174 CTGGCTGCACTCCAGGTTCTGGG - Intergenic
1201034471 Y:9773546-9773568 CTGGCTGCACTCCAGGTTCTGGG + Intergenic