ID: 1003494725

View in Genome Browser
Species Human (GRCh38)
Location 6:6654004-6654026
Sequence ACATCAGCTTCCACTCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003494725_1003494733 11 Left 1003494725 6:6654004-6654026 CCTTTCAGAGTGGAAGCTGATGT 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1003494733 6:6654038-6654060 CCTTTGAGGCCCTAAGAGTCTGG 0: 1
1: 1
2: 3
3: 10
4: 121
1003494725_1003494727 -3 Left 1003494725 6:6654004-6654026 CCTTTCAGAGTGGAAGCTGATGT 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1003494727 6:6654024-6654046 TGTCCCCACCATGGCCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003494725 Original CRISPR ACATCAGCTTCCACTCTGAA AGG (reversed) Intronic
900982070 1:6051577-6051599 GCAGCAGGTGCCACTCTGAATGG + Exonic
900989811 1:6093156-6093178 ACCTCAGCTTCCACGCAGCATGG + Intronic
901322988 1:8350601-8350623 ATCTCAGCTTCCACACAGAAGGG + Intergenic
901616236 1:10541835-10541857 CTATCAGCTCCCGCTCTGAATGG - Intronic
903838678 1:26222783-26222805 TCATCAGCTTCCACTCTGGTTGG + Intergenic
904405774 1:30287053-30287075 ACACCAACTTCCACTATGAGGGG - Intergenic
904406091 1:30289060-30289082 AAAGCAGCTTCCACTGTCAAGGG - Intergenic
905560262 1:38920929-38920951 ACATCAGTTTCCAGTTTGAGGGG + Intronic
907609948 1:55858930-55858952 ACATAAGTTTTCTCTCTGAAGGG - Intergenic
908446571 1:64203489-64203511 ACAACAGTTTCCCCTTTGAAAGG - Intergenic
909808003 1:79895164-79895186 ACACCAGCATCCATTCTGATTGG - Intergenic
910095721 1:83519510-83519532 ATATCAGAATCCCCTCTGAAAGG + Intergenic
911658877 1:100476958-100476980 ACATCGGCTTCTCCTCTAAATGG - Intronic
912190048 1:107327393-107327415 AGATCAGCTTCTATGCTGAAAGG - Intronic
912379321 1:109238693-109238715 ACATCAGCCTCCCCTGAGAAAGG - Intergenic
914353903 1:146865123-146865145 ATCTCAGCTTCCATTCTGACTGG + Intergenic
918040663 1:180912487-180912509 TCCTCAGCTTCCACCCCGAAAGG + Intergenic
921629179 1:217413179-217413201 ACAGAATCTTCCACACTGAAAGG - Intergenic
922939901 1:229453766-229453788 ACATTTGCCTCCACTGTGAATGG + Intronic
923371600 1:233319404-233319426 ACTTCAGTTTCCTGTCTGAAAGG - Intergenic
924630737 1:245738049-245738071 AACTCATCTTTCACTCTGAAGGG + Intergenic
1062816318 10:503620-503642 ACCACAGCTTCCACCCTGAGAGG + Intronic
1065226263 10:23546593-23546615 ATATCAGCTTCTACTTTGAAAGG - Intergenic
1067533720 10:47092905-47092927 ACTCCAGCCTCCTCTCTGAAGGG + Intergenic
1067752255 10:48979344-48979366 ATATCTGCTTCCACTTGGAAAGG + Intronic
1067921768 10:50465746-50465768 ACATCAGTTTCCAAGCTGAGAGG + Intronic
1068867074 10:61905264-61905286 ACATCAGCATCCATTTCGAAAGG + Intronic
1068911510 10:62382946-62382968 ACATCAGCTTCTCCTCCCAAAGG - Intronic
1069139332 10:64803927-64803949 TCATAAGCTCCTACTCTGAATGG + Intergenic
1069406920 10:68111228-68111250 AAATCAGGTTCCATTTTGAAAGG + Intronic
1071404980 10:85320857-85320879 ACATCAGCTTCACCTCTGGCTGG + Intergenic
1071964778 10:90841611-90841633 ACATCATCTTCTTCTCTGAAAGG + Intronic
1073636028 10:105200010-105200032 ACTTCAGCCTCCGCTCCGAATGG + Exonic
1073642229 10:105264293-105264315 AAAACAGCTTCCTCTCTAAAAGG + Exonic
1073765042 10:106672952-106672974 ACTTCAGCCACCGCTCTGAATGG - Exonic
1076509363 10:131001276-131001298 GAAACAGCTACCACTCTGAAAGG + Intergenic
1080720674 11:34845349-34845371 TCTTCACCTTCCACTATGAATGG + Intergenic
1081335165 11:41856456-41856478 CCTTCACCTTCCACTCTGAGTGG + Intergenic
1084093662 11:66895835-66895857 ACATGAGTTTCCACACTGGAAGG + Intronic
1088350397 11:108880474-108880496 ACATCATCTTAATCTCTGAAGGG + Intronic
1089926485 11:122263818-122263840 TCATCATCTTTCCCTCTGAATGG - Intergenic
1092995842 12:13949487-13949509 ACGGCAGCTTCCACACTTAAAGG - Intronic
1101850286 12:108396574-108396596 ACAGAAGGATCCACTCTGAATGG + Intergenic
1103859605 12:124001759-124001781 ACTGCAGCTTGCACTCGGAAAGG + Intronic
1104171711 12:126288053-126288075 AAATCAGCTTGACCTCTGAAGGG - Intergenic
1105384127 13:19914414-19914436 ACATGAACTTCCACTCTCCAAGG + Intergenic
1105692495 13:22855992-22856014 AAATCAGCTTCCACACTGAGAGG + Intergenic
1106002577 13:25738148-25738170 ACAGCATCTTGCACTCTAAAAGG - Intronic
1112355504 13:98671735-98671757 ACATGAGTTTCCAGTTTGAAAGG + Intergenic
1112418099 13:99221645-99221667 CCATCAGCTTCCATCCTCAATGG - Intronic
1115329682 14:32182886-32182908 ACATAAGCTGAGACTCTGAAAGG - Intergenic
1116059026 14:39897804-39897826 ACATAAACTTCCACTCACAAAGG + Intergenic
1118001094 14:61524652-61524674 TGGTCAGCTTCCACTCTAAAGGG - Intronic
1120069247 14:80084517-80084539 ACATCCTTTTCCACTCTGTATGG + Intergenic
1126301084 15:47196702-47196724 ACCTCAGCTTACAATATGAAAGG - Intronic
1127735603 15:61835799-61835821 ACATCTGCTTCCACGTTGACTGG + Intergenic
1129126132 15:73442952-73442974 ACATCAACTTCCACTAATAAGGG + Intergenic
1129534344 15:76299748-76299770 ACAGCAGCTTCCATTGTGATAGG - Intronic
1129928038 15:79383722-79383744 ACATCAGCTTTATCTCTGGAGGG - Intronic
1131639080 15:94270461-94270483 ACATCAGCTTTTACTGTGAGTGG - Intronic
1132073289 15:98798405-98798427 ACTTCGGCTTTGACTCTGAAAGG + Intronic
1135876292 16:26203490-26203512 ACTTCAGCTTTTACTCTGAGAGG + Intergenic
1136603060 16:31310058-31310080 AGATCAGCTGCCAGTCTGATGGG + Intronic
1136653892 16:31697491-31697513 AGATCAGATTCCACTTTGACTGG - Intergenic
1139333559 16:66213694-66213716 ATTTCAACTTCCACTGTGAATGG - Intergenic
1139429263 16:66902395-66902417 ACAACTACATCCACTCTGAAAGG + Intergenic
1139668926 16:68478597-68478619 ACATCTGCTCTCACTCTGGAAGG - Intergenic
1139980117 16:70850397-70850419 ATCTCAGCTTCCATTCTGACTGG - Intronic
1143928598 17:10396694-10396716 ACTTCTGCTTCCATTCTGATAGG + Exonic
1144353490 17:14422246-14422268 TCATGAGCATCCATTCTGAATGG + Intergenic
1144426898 17:15151658-15151680 ACATCACCTCCCTCTCTAAAAGG + Intergenic
1144575544 17:16427371-16427393 CCCTCAGCTTCAGCTCTGAAGGG + Intronic
1146463416 17:33066123-33066145 ACATCAGCTGCCACGGGGAAAGG - Intronic
1147569556 17:41560255-41560277 ACATGAGCTTCCATTCTAACTGG - Intergenic
1148630216 17:49101591-49101613 AAATGACCTTCCACTCTAAAGGG - Intergenic
1149526626 17:57361033-57361055 CCATCTGCTTCCTTTCTGAAGGG + Intronic
1149527393 17:57367373-57367395 CCATCTGCTTCCCTTCTGAAGGG + Intronic
1158170414 18:54592835-54592857 CCATCACCTTCCTCTCTGAAAGG + Intronic
1166871786 19:45875554-45875576 GCCTCAGTTTCCATTCTGAAAGG - Intergenic
925573838 2:5339527-5339549 TCATAAACCTCCACTCTGAAAGG - Intergenic
926567679 2:14494991-14495013 ACATGAGCTTCTACTCTGTGTGG + Intergenic
928922891 2:36543805-36543827 AGATCAGCTTCTAATCTAAATGG + Intronic
929915258 2:46129771-46129793 TCAGCAGCTTCCAATCTGCAAGG - Intronic
931077239 2:58729356-58729378 ACATAATCTTCCACTCTCATAGG - Intergenic
932494296 2:72138851-72138873 GGATCAGCTCCCACTCTGGAGGG - Intronic
935853043 2:107243822-107243844 ACAGCAGCTGCAACTCTGAGTGG - Intergenic
936043270 2:109166073-109166095 CCACCAGTCTCCACTCTGAAAGG - Intronic
937735550 2:125283458-125283480 AAATCAGCTTGCAGTCTGACAGG - Intergenic
937996465 2:127698260-127698282 ACATCAACGTCCACTGTGAATGG + Intergenic
938742265 2:134244112-134244134 AGATTTGCTTCCACTCTCAAAGG - Intronic
940143487 2:150521590-150521612 ACTTCAGCATCTACTCTGACAGG - Intronic
943022712 2:182594804-182594826 CCACCAGCATCCATTCTGAATGG - Intergenic
947239428 2:227978162-227978184 ACATGCGCTTACACTGTGAAAGG + Intergenic
1169378986 20:5090237-5090259 ACATGAGTTTCCAGACTGAAAGG + Intronic
1169721126 20:8677496-8677518 ACAACAGCTTTCAGACTGAAAGG + Intronic
1173400581 20:42722467-42722489 ACATCTGCTTCTACTGTAAATGG + Intronic
1173845544 20:46186273-46186295 ACTTCAGTCTCCACTCAGAACGG + Intronic
1174426753 20:50437158-50437180 CCACCAGCAGCCACTCTGAATGG - Intergenic
1174823317 20:53745996-53746018 AAATCAGGTACAACTCTGAAAGG + Intergenic
1174976862 20:55345490-55345512 GCATGAGCTTCCATTCTAAAGGG + Intergenic
1176256442 20:64155539-64155561 TCATCACCTTCCACCCTGCAGGG - Intronic
1182117491 22:27765590-27765612 AGCTCAGCTTCAACTCTGAAAGG + Intronic
1183652866 22:39168976-39168998 ACGTCTGTTTCCCCTCTGAAAGG - Intergenic
1184596769 22:45518672-45518694 ACATCCGCGTCCACTGTGCAGGG - Exonic
949093637 3:60084-60106 CCTTCACCTTCCACTCTGAGTGG + Intergenic
949127546 3:464544-464566 CCTTCAGCTTCCACTGTGACTGG - Intergenic
949128809 3:476901-476923 TCTTCAGGTTCCACACTGAAAGG - Intergenic
950284013 3:11730791-11730813 AAAACCGCTTCCATTCTGAAGGG + Intergenic
951857968 3:27218908-27218930 CCAACAGCTTCCACTCAGACGGG + Intronic
951896400 3:27613591-27613613 GCATCAGCTTCAAATCTGAGAGG + Intergenic
951970643 3:28441012-28441034 ACATCAACTTCCACTCACCAAGG - Intronic
952541973 3:34376344-34376366 GCATCAGCTGCCACGTTGAAAGG + Intergenic
956600697 3:71019055-71019077 ACACCAGCTGCACCTCTGAATGG + Intronic
960700338 3:120433142-120433164 ACATTAGCTTCCTCTGGGAATGG + Intronic
963269331 3:143270153-143270175 ACAACAGCTGCCCATCTGAAAGG - Intronic
963427850 3:145155162-145155184 ACTTCACCTTCCACTATGAGTGG - Intergenic
965643818 3:170859125-170859147 ACATCACCTTCATATCTGAACGG + Intronic
969527772 4:7712744-7712766 ACATCAGCTTCCGCTCCGATTGG + Exonic
969667388 4:8567959-8567981 ACTTCAGTTTCCCCTGTGAAAGG - Intronic
970216633 4:13765623-13765645 ACCTCAGCTTCCTCTCTTATTGG + Intergenic
971147844 4:23998239-23998261 TAATCATTTTCCACTCTGAAGGG - Intergenic
972393402 4:38634582-38634604 ACATCTGCTTCCACTCTGGCAGG + Intergenic
973230453 4:47835034-47835056 ACAGCACCTTCTACTCTTAAGGG + Intronic
973238785 4:47934575-47934597 ACATCAGATTCCTCTCTACATGG + Intronic
973756264 4:54076829-54076851 AAATCACTTTGCACTCTGAAAGG - Intronic
975868661 4:78753359-78753381 ACATGAGCTTCCACTGCGATAGG - Intergenic
976602972 4:86955739-86955761 ACTTCAGTACCCACTCTGAATGG - Intronic
977700160 4:100012812-100012834 ACATGAGTTTCCAAACTGAAAGG - Intergenic
981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG + Intronic
984560868 4:181268166-181268188 AAATCAATTTGCACTCTGAACGG - Intergenic
986162686 5:5244862-5244884 AGATCAGCCTTCACCCTGAATGG - Intronic
988215759 5:28270023-28270045 ACTTCAGCTTCTATCCTGAATGG + Intergenic
993263002 5:85684784-85684806 AGATTAGCTGCCACTCTAAATGG - Intergenic
993773968 5:91967940-91967962 ACAGCAGCTTTCAGTCTCAAAGG - Intergenic
995529332 5:113076438-113076460 AAATCAGCTACTACTCTGATGGG - Intronic
995547293 5:113245828-113245850 ACAGCAACTGCCACTTTGAAAGG + Intronic
995783827 5:115807126-115807148 ACAAAAGCTTCCATACTGAATGG + Intronic
995860924 5:116639613-116639635 ACTTCTCCTTCCACTGTGAATGG - Intergenic
995933931 5:117485644-117485666 ACATCAGGTTCCCCTCAGAGGGG + Intergenic
996341575 5:122444411-122444433 ACATCATCATAGACTCTGAAGGG + Intronic
998250899 5:140551681-140551703 TCAGCAGCTTCTGCTCTGAATGG + Intronic
999716066 5:154361226-154361248 GCATATGCTTCCACTATGAAAGG + Intronic
999893818 5:156007203-156007225 GCACCAGCTTCCACTCTGCTTGG + Intronic
1002051975 5:176576394-176576416 ACGTCAGCCTCCACTCAGCATGG - Intronic
1003494725 6:6654004-6654026 ACATCAGCTTCCACTCTGAAAGG - Intronic
1003790656 6:9543793-9543815 CCTTCAGCTTCCACTGTGATTGG - Intergenic
1005225342 6:23636031-23636053 ACAACAGCTTCAACTGTGAAGGG + Intergenic
1006402890 6:33828071-33828093 ACTTTGGCTTCCACTCTGAGTGG - Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1007932473 6:45704755-45704777 GCAATAGCTTACACTCTGAAGGG + Intergenic
1008166498 6:48145312-48145334 ACATCAGCTTCTGCTCTGCCAGG + Intergenic
1014054726 6:117000664-117000686 CCATAAGCCTCCACTGTGAAGGG + Intergenic
1015759041 6:136637750-136637772 CCATCAGCCTCCTCTCTGAATGG - Intronic
1015862162 6:137692357-137692379 ACATCAGCTTCCACTCACCAAGG + Intergenic
1015938951 6:138430506-138430528 ACATTGGCTTCCACTCTGCTGGG + Exonic
1019050127 6:169176478-169176500 TCTTCAGCCTCCACTCTGCATGG - Intergenic
1019211891 6:170413348-170413370 AAACCAGCTTCTACTGTGAAGGG - Intergenic
1019487026 7:1294114-1294136 GCATCACCTTCCACTCAGGAGGG - Intergenic
1019506138 7:1392447-1392469 ACATCACCTTCCACCATGATTGG + Intergenic
1019579822 7:1755967-1755989 ACACCTGCTTCCCCTCTGGAGGG - Intergenic
1021415537 7:20379258-20379280 ACATTAGCATCCACCCCGAAAGG + Exonic
1022070895 7:26913123-26913145 ACATCAGTTTCCACTCCCAATGG - Intronic
1023649968 7:42359408-42359430 TCCTCAGTTTCCACTATGAATGG - Intergenic
1028708514 7:93879759-93879781 ACATCAGAATCAACTCTAAATGG + Intronic
1030012679 7:105186767-105186789 AACACAGCTTCCACTCTGGAAGG + Intronic
1030933205 7:115551252-115551274 ACATCAGCTTACACAATGCAAGG - Intergenic
1033221838 7:139531959-139531981 ACATCACTTTCCACATTGAAAGG + Intronic
1033946960 7:146730911-146730933 ACATCAGCTTCCATTTTCAAAGG + Intronic
1034595554 7:152187399-152187421 TCATCAGCTCCCACTGTGGAAGG - Exonic
1035606414 8:933107-933129 ACAGCAGCTGCCACTGTGCAGGG - Intergenic
1036966259 8:13301591-13301613 ACATCTGCTTCCTATCTGTATGG - Intronic
1038092850 8:24273546-24273568 TCATTACCTTCCACTCTGCAGGG - Intergenic
1040708304 8:50155728-50155750 ACATCACCTTTCACTCTATAGGG + Intronic
1042017553 8:64332136-64332158 AAATCACTTTGCACTCTGAAAGG - Intergenic
1044099301 8:88112466-88112488 ACAACAGCTTACACTCTTCAAGG + Intronic
1044838835 8:96320844-96320866 ATATCACCTTCCGCTCTGAAGGG + Intronic
1045854972 8:106754512-106754534 ACAACAGCTTTCACTCTTATTGG - Intergenic
1050499034 9:6275076-6275098 ACCTCATCTTCAATTCTGAAAGG + Intergenic
1051931600 9:22392932-22392954 AATGTAGCTTCCACTCTGAAAGG + Intergenic
1052645762 9:31231368-31231390 ACATCAGCTGTCTATCTGAAAGG + Intergenic
1053284939 9:36844066-36844088 ACAACAGAATCCACTCTGACTGG - Intronic
1054790680 9:69253753-69253775 ACTTCAGCTTCCAGTCAGAATGG - Intronic
1055155090 9:73053233-73053255 ACAGCAGACACCACTCTGAATGG + Intronic
1055371946 9:75609357-75609379 GGATCATCTTCCACTCTGAAAGG - Intergenic
1056774139 9:89498802-89498824 TCATCATTTTCCACTCTGTATGG + Intergenic
1057024988 9:91727956-91727978 CTAGCAGCTTCCCCTCTGAAAGG + Intronic
1058102603 9:100933846-100933868 ACATCACATTCCAGTCAGAATGG - Intergenic
1058245293 9:102615647-102615669 CCTTTACCTTCCACTCTGAAGGG + Intergenic
1061387776 9:130300660-130300682 ACAGCAGCTGCCACACTGGAGGG - Intronic
1186279630 X:7977991-7978013 ACATGAGCTTCCACTCACCAAGG + Intergenic
1186728843 X:12386146-12386168 ACACCTGGTTTCACTCTGAAGGG - Intronic
1187854767 X:23626143-23626165 GCATCAGCTTCCACCATGAATGG - Intergenic
1189727578 X:43983726-43983748 ACATCAGTCTCCCATCTGAAGGG - Intergenic
1193070820 X:77303778-77303800 TCATCAACTGCCACTCTCAAGGG + Intergenic
1193789619 X:85801862-85801884 ACATCAGCTTCCGCCATGAGTGG - Intergenic
1195706814 X:107743215-107743237 GCACCAGCTTCCACACTGGAAGG + Intronic
1199419769 X:147631365-147631387 TCATCAGCTTCTGCTCTGCATGG - Intergenic
1201067409 Y:10111318-10111340 AGATCAGCTGTTACTCTGAAGGG + Intergenic
1201708006 Y:16958000-16958022 ACATCACCTTCATATCTGAATGG + Intergenic