ID: 1003495760

View in Genome Browser
Species Human (GRCh38)
Location 6:6661874-6661896
Sequence CTCGTTGGCAGACTTCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003495756_1003495760 2 Left 1003495756 6:6661849-6661871 CCAGGCTCTAATTGTGTAACAGG No data
Right 1003495760 6:6661874-6661896 CTCGTTGGCAGACTTCCAACTGG No data
1003495755_1003495760 10 Left 1003495755 6:6661841-6661863 CCAGAGAACCAGGCTCTAATTGT No data
Right 1003495760 6:6661874-6661896 CTCGTTGGCAGACTTCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003495760 Original CRISPR CTCGTTGGCAGACTTCCAAC TGG Intergenic
No off target data available for this crispr