ID: 1003499429

View in Genome Browser
Species Human (GRCh38)
Location 6:6692099-6692121
Sequence CCCTGGGTGGAACAGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003499429_1003499439 7 Left 1003499429 6:6692099-6692121 CCCTCTAGCTGTTCCACCCAGGG No data
Right 1003499439 6:6692129-6692151 CCTGTCCTTTCCTTTGGTGATGG No data
1003499429_1003499444 27 Left 1003499429 6:6692099-6692121 CCCTCTAGCTGTTCCACCCAGGG No data
Right 1003499444 6:6692149-6692171 TGGAGTGTAGAAGGCAGGCGTGG No data
1003499429_1003499437 1 Left 1003499429 6:6692099-6692121 CCCTCTAGCTGTTCCACCCAGGG No data
Right 1003499437 6:6692123-6692145 CTCTGGCCTGTCCTTTCCTTTGG No data
1003499429_1003499442 18 Left 1003499429 6:6692099-6692121 CCCTCTAGCTGTTCCACCCAGGG No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499429_1003499443 22 Left 1003499429 6:6692099-6692121 CCCTCTAGCTGTTCCACCCAGGG No data
Right 1003499443 6:6692144-6692166 GGTGATGGAGTGTAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003499429 Original CRISPR CCCTGGGTGGAACAGCTAGA GGG (reversed) Intergenic
No off target data available for this crispr