ID: 1003499433

View in Genome Browser
Species Human (GRCh38)
Location 6:6692112-6692134
Sequence GACAGGCCAGAGGCCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003499433_1003499444 14 Left 1003499433 6:6692112-6692134 CCACCCAGGGCCTCTGGCCTGTC No data
Right 1003499444 6:6692149-6692171 TGGAGTGTAGAAGGCAGGCGTGG No data
1003499433_1003499443 9 Left 1003499433 6:6692112-6692134 CCACCCAGGGCCTCTGGCCTGTC No data
Right 1003499443 6:6692144-6692166 GGTGATGGAGTGTAGAAGGCAGG No data
1003499433_1003499439 -6 Left 1003499433 6:6692112-6692134 CCACCCAGGGCCTCTGGCCTGTC No data
Right 1003499439 6:6692129-6692151 CCTGTCCTTTCCTTTGGTGATGG No data
1003499433_1003499442 5 Left 1003499433 6:6692112-6692134 CCACCCAGGGCCTCTGGCCTGTC No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003499433 Original CRISPR GACAGGCCAGAGGCCCTGGG TGG (reversed) Intergenic
No off target data available for this crispr