ID: 1003499434

View in Genome Browser
Species Human (GRCh38)
Location 6:6692115-6692137
Sequence AAGGACAGGCCAGAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003499434_1003499439 -9 Left 1003499434 6:6692115-6692137 CCCAGGGCCTCTGGCCTGTCCTT No data
Right 1003499439 6:6692129-6692151 CCTGTCCTTTCCTTTGGTGATGG No data
1003499434_1003499444 11 Left 1003499434 6:6692115-6692137 CCCAGGGCCTCTGGCCTGTCCTT No data
Right 1003499444 6:6692149-6692171 TGGAGTGTAGAAGGCAGGCGTGG No data
1003499434_1003499442 2 Left 1003499434 6:6692115-6692137 CCCAGGGCCTCTGGCCTGTCCTT No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499434_1003499443 6 Left 1003499434 6:6692115-6692137 CCCAGGGCCTCTGGCCTGTCCTT No data
Right 1003499443 6:6692144-6692166 GGTGATGGAGTGTAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003499434 Original CRISPR AAGGACAGGCCAGAGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr