ID: 1003499436

View in Genome Browser
Species Human (GRCh38)
Location 6:6692122-6692144
Sequence CAAAGGAAAGGACAGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003499436_1003499442 -5 Left 1003499436 6:6692122-6692144 CCTCTGGCCTGTCCTTTCCTTTG No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499436_1003499444 4 Left 1003499436 6:6692122-6692144 CCTCTGGCCTGTCCTTTCCTTTG No data
Right 1003499444 6:6692149-6692171 TGGAGTGTAGAAGGCAGGCGTGG No data
1003499436_1003499443 -1 Left 1003499436 6:6692122-6692144 CCTCTGGCCTGTCCTTTCCTTTG No data
Right 1003499443 6:6692144-6692166 GGTGATGGAGTGTAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003499436 Original CRISPR CAAAGGAAAGGACAGGCCAG AGG (reversed) Intergenic
No off target data available for this crispr