ID: 1003499442

View in Genome Browser
Species Human (GRCh38)
Location 6:6692140-6692162
Sequence CTTTGGTGATGGAGTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003499435_1003499442 1 Left 1003499435 6:6692116-6692138 CCAGGGCCTCTGGCCTGTCCTTT No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499431_1003499442 17 Left 1003499431 6:6692100-6692122 CCTCTAGCTGTTCCACCCAGGGC No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499434_1003499442 2 Left 1003499434 6:6692115-6692137 CCCAGGGCCTCTGGCCTGTCCTT No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499429_1003499442 18 Left 1003499429 6:6692099-6692121 CCCTCTAGCTGTTCCACCCAGGG No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499433_1003499442 5 Left 1003499433 6:6692112-6692134 CCACCCAGGGCCTCTGGCCTGTC No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data
1003499436_1003499442 -5 Left 1003499436 6:6692122-6692144 CCTCTGGCCTGTCCTTTCCTTTG No data
Right 1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003499442 Original CRISPR CTTTGGTGATGGAGTGTAGA AGG Intergenic
No off target data available for this crispr