ID: 1003499725

View in Genome Browser
Species Human (GRCh38)
Location 6:6694499-6694521
Sequence CTCCATCGCAAGCCCTGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003499725_1003499735 23 Left 1003499725 6:6694499-6694521 CCGTGGCAGGGCTTGCGATGGAG No data
Right 1003499735 6:6694545-6694567 CCGCTGCTCAAACCTGTAGGGGG No data
1003499725_1003499729 20 Left 1003499725 6:6694499-6694521 CCGTGGCAGGGCTTGCGATGGAG No data
Right 1003499729 6:6694542-6694564 GCCCCGCTGCTCAAACCTGTAGG No data
1003499725_1003499733 22 Left 1003499725 6:6694499-6694521 CCGTGGCAGGGCTTGCGATGGAG No data
Right 1003499733 6:6694544-6694566 CCCGCTGCTCAAACCTGTAGGGG No data
1003499725_1003499731 21 Left 1003499725 6:6694499-6694521 CCGTGGCAGGGCTTGCGATGGAG No data
Right 1003499731 6:6694543-6694565 CCCCGCTGCTCAAACCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003499725 Original CRISPR CTCCATCGCAAGCCCTGCCA CGG (reversed) Intergenic
No off target data available for this crispr