ID: 1003500654

View in Genome Browser
Species Human (GRCh38)
Location 6:6700268-6700290
Sequence CTCCTCTGAAAGCTGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003500648_1003500654 13 Left 1003500648 6:6700232-6700254 CCAGGCAGATGCAGAGCAGTTGG No data
Right 1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003500654 Original CRISPR CTCCTCTGAAAGCTGGGCCA AGG Intergenic
No off target data available for this crispr