ID: 1003501229

View in Genome Browser
Species Human (GRCh38)
Location 6:6704554-6704576
Sequence ATTTATGCCCAGAGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003501229_1003501232 2 Left 1003501229 6:6704554-6704576 CCCAGAGGCCTCTGGGCATAAAT No data
Right 1003501232 6:6704579-6704601 GCACTTATCAAATCCACGAGAGG No data
1003501229_1003501235 24 Left 1003501229 6:6704554-6704576 CCCAGAGGCCTCTGGGCATAAAT No data
Right 1003501235 6:6704601-6704623 GCAAACAGCCATCTGCAGGCTGG No data
1003501229_1003501234 20 Left 1003501229 6:6704554-6704576 CCCAGAGGCCTCTGGGCATAAAT No data
Right 1003501234 6:6704597-6704619 AGAGGCAAACAGCCATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003501229 Original CRISPR ATTTATGCCCAGAGGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr