ID: 1003504571

View in Genome Browser
Species Human (GRCh38)
Location 6:6729174-6729196
Sequence GAGGCACTGCGCATGGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003504571_1003504575 13 Left 1003504571 6:6729174-6729196 CCAGTATCCATGCGCAGTGCCTC No data
Right 1003504575 6:6729210-6729232 TCTGCTGCCTTACGCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003504571 Original CRISPR GAGGCACTGCGCATGGATAC TGG (reversed) Intergenic
No off target data available for this crispr