ID: 1003506110

View in Genome Browser
Species Human (GRCh38)
Location 6:6741503-6741525
Sequence GATACTGATGTCTCCAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003506108_1003506110 -10 Left 1003506108 6:6741490-6741512 CCTACAGTGTCTGGATACTGATG No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506100_1003506110 23 Left 1003506100 6:6741457-6741479 CCTTCCAAATCCCCACTGGTCAC No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506107_1003506110 -7 Left 1003506107 6:6741487-6741509 CCTCCTACAGTGTCTGGATACTG No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506105_1003506110 1 Left 1003506105 6:6741479-6741501 CCACAGCACCTCCTACAGTGTCT No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506103_1003506110 12 Left 1003506103 6:6741468-6741490 CCCACTGGTCACCACAGCACCTC No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506104_1003506110 11 Left 1003506104 6:6741469-6741491 CCACTGGTCACCACAGCACCTCC No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506102_1003506110 13 Left 1003506102 6:6741467-6741489 CCCCACTGGTCACCACAGCACCT No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data
1003506101_1003506110 19 Left 1003506101 6:6741461-6741483 CCAAATCCCCACTGGTCACCACA No data
Right 1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003506110 Original CRISPR GATACTGATGTCTCCAAGGC TGG Intergenic
No off target data available for this crispr