ID: 1003514557

View in Genome Browser
Species Human (GRCh38)
Location 6:6807094-6807116
Sequence AAAGAGAAGTAAACAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003514551_1003514557 3 Left 1003514551 6:6807068-6807090 CCCAGGCATAATGGACATATGAT No data
Right 1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG No data
1003514552_1003514557 2 Left 1003514552 6:6807069-6807091 CCAGGCATAATGGACATATGATG No data
Right 1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG No data
1003514550_1003514557 4 Left 1003514550 6:6807067-6807089 CCCCAGGCATAATGGACATATGA No data
Right 1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003514557 Original CRISPR AAAGAGAAGTAAACAGGGGC GGG Intergenic
No off target data available for this crispr