ID: 1003515117

View in Genome Browser
Species Human (GRCh38)
Location 6:6811438-6811460
Sequence GTGATTTGGAAGCCGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003515108_1003515117 26 Left 1003515108 6:6811389-6811411 CCTACAAAAGTTATCTGGAGCTA No data
Right 1003515117 6:6811438-6811460 GTGATTTGGAAGCCGGGCCAAGG No data
1003515107_1003515117 27 Left 1003515107 6:6811388-6811410 CCCTACAAAAGTTATCTGGAGCT No data
Right 1003515117 6:6811438-6811460 GTGATTTGGAAGCCGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003515117 Original CRISPR GTGATTTGGAAGCCGGGCCA AGG Intergenic
No off target data available for this crispr