ID: 1003516521

View in Genome Browser
Species Human (GRCh38)
Location 6:6823152-6823174
Sequence ACCATGAGACGAATGCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003516521_1003516526 13 Left 1003516521 6:6823152-6823174 CCTCGCAGCATTCGTCTCATGGT No data
Right 1003516526 6:6823188-6823210 CAGGTGTCAGCATCAAGTCCTGG No data
1003516521_1003516522 -6 Left 1003516521 6:6823152-6823174 CCTCGCAGCATTCGTCTCATGGT No data
Right 1003516522 6:6823169-6823191 CATGGTGAGCCTTCCTCCACAGG No data
1003516521_1003516527 26 Left 1003516521 6:6823152-6823174 CCTCGCAGCATTCGTCTCATGGT No data
Right 1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG No data
1003516521_1003516528 27 Left 1003516521 6:6823152-6823174 CCTCGCAGCATTCGTCTCATGGT No data
Right 1003516528 6:6823202-6823224 AAGTCCTGGAAATCACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003516521 Original CRISPR ACCATGAGACGAATGCTGCG AGG (reversed) Intergenic