ID: 1003516523

View in Genome Browser
Species Human (GRCh38)
Location 6:6823178-6823200
Sequence ATGCTGACACCTGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003516523_1003516532 30 Left 1003516523 6:6823178-6823200 CCTTCCTCCACAGGTGTCAGCAT No data
Right 1003516532 6:6823231-6823253 CACCTGCCAGCCACCACCCCTGG No data
1003516523_1003516528 1 Left 1003516523 6:6823178-6823200 CCTTCCTCCACAGGTGTCAGCAT No data
Right 1003516528 6:6823202-6823224 AAGTCCTGGAAATCACACCTGGG No data
1003516523_1003516527 0 Left 1003516523 6:6823178-6823200 CCTTCCTCCACAGGTGTCAGCAT No data
Right 1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003516523 Original CRISPR ATGCTGACACCTGTGGAGGA AGG (reversed) Intergenic