ID: 1003516525 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:6823185-6823207 |
| Sequence | GGACTTGATGCTGACACCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003516525_1003516532 | 23 | Left | 1003516525 | 6:6823185-6823207 | CCACAGGTGTCAGCATCAAGTCC | No data | ||
| Right | 1003516532 | 6:6823231-6823253 | CACCTGCCAGCCACCACCCCTGG | No data | ||||
| 1003516525_1003516527 | -7 | Left | 1003516525 | 6:6823185-6823207 | CCACAGGTGTCAGCATCAAGTCC | No data | ||
| Right | 1003516527 | 6:6823201-6823223 | CAAGTCCTGGAAATCACACCTGG | No data | ||||
| 1003516525_1003516528 | -6 | Left | 1003516525 | 6:6823185-6823207 | CCACAGGTGTCAGCATCAAGTCC | No data | ||
| Right | 1003516528 | 6:6823202-6823224 | AAGTCCTGGAAATCACACCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003516525 | Original CRISPR | GGACTTGATGCTGACACCTG TGG (reversed) | Intergenic | ||