ID: 1003516525 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:6823185-6823207 |
Sequence | GGACTTGATGCTGACACCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003516525_1003516528 | -6 | Left | 1003516525 | 6:6823185-6823207 | CCACAGGTGTCAGCATCAAGTCC | No data | ||
Right | 1003516528 | 6:6823202-6823224 | AAGTCCTGGAAATCACACCTGGG | No data | ||||
1003516525_1003516532 | 23 | Left | 1003516525 | 6:6823185-6823207 | CCACAGGTGTCAGCATCAAGTCC | No data | ||
Right | 1003516532 | 6:6823231-6823253 | CACCTGCCAGCCACCACCCCTGG | No data | ||||
1003516525_1003516527 | -7 | Left | 1003516525 | 6:6823185-6823207 | CCACAGGTGTCAGCATCAAGTCC | No data | ||
Right | 1003516527 | 6:6823201-6823223 | CAAGTCCTGGAAATCACACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003516525 | Original CRISPR | GGACTTGATGCTGACACCTG TGG (reversed) | Intergenic | ||