ID: 1003516527

View in Genome Browser
Species Human (GRCh38)
Location 6:6823201-6823223
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003516525_1003516527 -7 Left 1003516525 6:6823185-6823207 CCACAGGTGTCAGCATCAAGTCC No data
Right 1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG No data
1003516521_1003516527 26 Left 1003516521 6:6823152-6823174 CCTCGCAGCATTCGTCTCATGGT No data
Right 1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG No data
1003516523_1003516527 0 Left 1003516523 6:6823178-6823200 CCTTCCTCCACAGGTGTCAGCAT No data
Right 1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG No data
1003516524_1003516527 -4 Left 1003516524 6:6823182-6823204 CCTCCACAGGTGTCAGCATCAAG No data
Right 1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003516527 Original CRISPR CAAGTCCTGGAAATCACACC TGG Intergenic