ID: 1003516529

View in Genome Browser
Species Human (GRCh38)
Location 6:6823206-6823228
Sequence CAAGCCCAGGTGTGATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003516529_1003516532 2 Left 1003516529 6:6823206-6823228 CCTGGAAATCACACCTGGGCTTG No data
Right 1003516532 6:6823231-6823253 CACCTGCCAGCCACCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003516529 Original CRISPR CAAGCCCAGGTGTGATTTCC AGG (reversed) Intergenic