ID: 1003516559

View in Genome Browser
Species Human (GRCh38)
Location 6:6823392-6823414
Sequence GGAGTCTTGCTGTGTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003516559_1003516563 16 Left 1003516559 6:6823392-6823414 CCTGTTCCACACAGCAAGACTCC No data
Right 1003516563 6:6823431-6823453 CTTTTTTAAAATCGGCTCAGTGG No data
1003516559_1003516564 17 Left 1003516559 6:6823392-6823414 CCTGTTCCACACAGCAAGACTCC No data
Right 1003516564 6:6823432-6823454 TTTTTTAAAATCGGCTCAGTGGG No data
1003516559_1003516562 8 Left 1003516559 6:6823392-6823414 CCTGTTCCACACAGCAAGACTCC No data
Right 1003516562 6:6823423-6823445 AAAATATTCTTTTTTAAAATCGG No data
1003516559_1003516565 18 Left 1003516559 6:6823392-6823414 CCTGTTCCACACAGCAAGACTCC No data
Right 1003516565 6:6823433-6823455 TTTTTAAAATCGGCTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003516559 Original CRISPR GGAGTCTTGCTGTGTGGAAC AGG (reversed) Intergenic
No off target data available for this crispr