ID: 1003520370

View in Genome Browser
Species Human (GRCh38)
Location 6:6853529-6853551
Sequence GCACCGTGCCTAGCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003520370_1003520375 8 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520375 6:6853560-6853582 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1003520370_1003520373 5 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520373 6:6853557-6853579 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1003520370_1003520380 18 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520380 6:6853570-6853592 GCACTTTGGGAGGTCGAGGTGGG 0: 1283
1: 42676
2: 192034
3: 269723
4: 180375
1003520370_1003520372 4 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520372 6:6853556-6853578 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
1003520370_1003520381 21 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520381 6:6853573-6853595 CTTTGGGAGGTCGAGGTGGGTGG 0: 972
1: 31105
2: 117173
3: 161521
4: 169093
1003520370_1003520377 14 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520377 6:6853566-6853588 CCCAGCACTTTGGGAGGTCGAGG 0: 3341
1: 124982
2: 268208
3: 211109
4: 126311
1003520370_1003520379 17 Left 1003520370 6:6853529-6853551 CCTGTCTTGGCTAGGCACGGTGC No data
Right 1003520379 6:6853569-6853591 AGCACTTTGGGAGGTCGAGGTGG 0: 2438
1: 95371
2: 188205
3: 135654
4: 71168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003520370 Original CRISPR GCACCGTGCCTAGCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr