ID: 1003522361

View in Genome Browser
Species Human (GRCh38)
Location 6:6868914-6868936
Sequence CCCCTTCCTGCTCTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003522361_1003522366 15 Left 1003522361 6:6868914-6868936 CCCAAAGAAAGAGCAGGAAGGGG No data
Right 1003522366 6:6868952-6868974 GAGCAGCTATCGCATGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003522361 Original CRISPR CCCCTTCCTGCTCTTTCTTT GGG (reversed) Intergenic
No off target data available for this crispr