ID: 1003524587

View in Genome Browser
Species Human (GRCh38)
Location 6:6887036-6887058
Sequence GCTGAAGGAGCCCCACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003524587_1003524593 6 Left 1003524587 6:6887036-6887058 CCACCTGGTGGGGCTCCTTCAGC No data
Right 1003524593 6:6887065-6887087 GGAAAGCAGGCCAAGGCCAGAGG No data
1003524587_1003524596 26 Left 1003524587 6:6887036-6887058 CCACCTGGTGGGGCTCCTTCAGC No data
Right 1003524596 6:6887085-6887107 AGGCAGCTGCTGTCTGAAGATGG No data
1003524587_1003524598 30 Left 1003524587 6:6887036-6887058 CCACCTGGTGGGGCTCCTTCAGC No data
Right 1003524598 6:6887089-6887111 AGCTGCTGTCTGAAGATGGGAGG No data
1003524587_1003524591 -7 Left 1003524587 6:6887036-6887058 CCACCTGGTGGGGCTCCTTCAGC No data
Right 1003524591 6:6887052-6887074 CTTCAGCAAGAGAGGAAAGCAGG No data
1003524587_1003524597 27 Left 1003524587 6:6887036-6887058 CCACCTGGTGGGGCTCCTTCAGC No data
Right 1003524597 6:6887086-6887108 GGCAGCTGCTGTCTGAAGATGGG No data
1003524587_1003524592 -1 Left 1003524587 6:6887036-6887058 CCACCTGGTGGGGCTCCTTCAGC No data
Right 1003524592 6:6887058-6887080 CAAGAGAGGAAAGCAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003524587 Original CRISPR GCTGAAGGAGCCCCACCAGG TGG (reversed) Intergenic
No off target data available for this crispr