ID: 1003527297

View in Genome Browser
Species Human (GRCh38)
Location 6:6909017-6909039
Sequence ACCTCAGAGAAACAAGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003527297_1003527299 5 Left 1003527297 6:6909017-6909039 CCACAATCTTGTTTCTCTGAGGT No data
Right 1003527299 6:6909045-6909067 TGCCTACATCCTAGACAAGGAGG No data
1003527297_1003527301 9 Left 1003527297 6:6909017-6909039 CCACAATCTTGTTTCTCTGAGGT No data
Right 1003527301 6:6909049-6909071 TACATCCTAGACAAGGAGGAAGG No data
1003527297_1003527298 2 Left 1003527297 6:6909017-6909039 CCACAATCTTGTTTCTCTGAGGT No data
Right 1003527298 6:6909042-6909064 ATATGCCTACATCCTAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003527297 Original CRISPR ACCTCAGAGAAACAAGATTG TGG (reversed) Intergenic
No off target data available for this crispr