ID: 1003528673

View in Genome Browser
Species Human (GRCh38)
Location 6:6919870-6919892
Sequence CAGAAGCACTGGGTGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003528673_1003528678 5 Left 1003528673 6:6919870-6919892 CCTACTTCCACCCAGTGCTTCTG No data
Right 1003528678 6:6919898-6919920 TGGTTTATCTGCCTCCTTTACGG No data
1003528673_1003528679 6 Left 1003528673 6:6919870-6919892 CCTACTTCCACCCAGTGCTTCTG No data
Right 1003528679 6:6919899-6919921 GGTTTATCTGCCTCCTTTACGGG No data
1003528673_1003528684 26 Left 1003528673 6:6919870-6919892 CCTACTTCCACCCAGTGCTTCTG No data
Right 1003528684 6:6919919-6919941 GGGAGACAGGGCATTTCAACTGG No data
1003528673_1003528680 13 Left 1003528673 6:6919870-6919892 CCTACTTCCACCCAGTGCTTCTG No data
Right 1003528680 6:6919906-6919928 CTGCCTCCTTTACGGGAGACAGG No data
1003528673_1003528681 14 Left 1003528673 6:6919870-6919892 CCTACTTCCACCCAGTGCTTCTG No data
Right 1003528681 6:6919907-6919929 TGCCTCCTTTACGGGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003528673 Original CRISPR CAGAAGCACTGGGTGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr