ID: 1003529769

View in Genome Browser
Species Human (GRCh38)
Location 6:6927963-6927985
Sequence GGACCCATGGAAGGACGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003529759_1003529769 21 Left 1003529759 6:6927919-6927941 CCGCGATAAAGGCGAAGAAGAGG No data
Right 1003529769 6:6927963-6927985 GGACCCATGGAAGGACGGGGTGG No data
1003529758_1003529769 28 Left 1003529758 6:6927912-6927934 CCAGGGGCCGCGATAAAGGCGAA No data
Right 1003529769 6:6927963-6927985 GGACCCATGGAAGGACGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003529769 Original CRISPR GGACCCATGGAAGGACGGGG TGG Intergenic