ID: 1003529769 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:6927963-6927985 |
Sequence | GGACCCATGGAAGGACGGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003529759_1003529769 | 21 | Left | 1003529759 | 6:6927919-6927941 | CCGCGATAAAGGCGAAGAAGAGG | No data | ||
Right | 1003529769 | 6:6927963-6927985 | GGACCCATGGAAGGACGGGGTGG | No data | ||||
1003529758_1003529769 | 28 | Left | 1003529758 | 6:6927912-6927934 | CCAGGGGCCGCGATAAAGGCGAA | No data | ||
Right | 1003529769 | 6:6927963-6927985 | GGACCCATGGAAGGACGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003529769 | Original CRISPR | GGACCCATGGAAGGACGGGG TGG | Intergenic | ||