ID: 1003532223

View in Genome Browser
Species Human (GRCh38)
Location 6:6947162-6947184
Sequence CATTGTGAAGACAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003532218_1003532223 -5 Left 1003532218 6:6947144-6947166 CCCCCTCAGACTACTCAACATTG No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532215_1003532223 7 Left 1003532215 6:6947132-6947154 CCTCTCCTTCCTCCCCCTCAGAC No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532212_1003532223 12 Left 1003532212 6:6947127-6947149 CCCCTCCTCTCCTTCCTCCCCCT No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532220_1003532223 -7 Left 1003532220 6:6947146-6947168 CCCTCAGACTACTCAACATTGTG No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532214_1003532223 10 Left 1003532214 6:6947129-6947151 CCTCCTCTCCTTCCTCCCCCTCA No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532219_1003532223 -6 Left 1003532219 6:6947145-6947167 CCCCTCAGACTACTCAACATTGT No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532221_1003532223 -8 Left 1003532221 6:6947147-6947169 CCTCAGACTACTCAACATTGTGA No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532216_1003532223 2 Left 1003532216 6:6947137-6947159 CCTTCCTCCCCCTCAGACTACTC No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532213_1003532223 11 Left 1003532213 6:6947128-6947150 CCCTCCTCTCCTTCCTCCCCCTC 0: 2
1: 23
2: 296
3: 1779
4: 8600
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532217_1003532223 -2 Left 1003532217 6:6947141-6947163 CCTCCCCCTCAGACTACTCAACA No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data
1003532211_1003532223 16 Left 1003532211 6:6947123-6947145 CCAACCCCTCCTCTCCTTCCTCC No data
Right 1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003532223 Original CRISPR CATTGTGAAGACAAGGATGA AGG Intergenic
No off target data available for this crispr