ID: 1003532595

View in Genome Browser
Species Human (GRCh38)
Location 6:6950217-6950239
Sequence CCCCTTGAGCACTTGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003532595_1003532600 15 Left 1003532595 6:6950217-6950239 CCTGGGCTCAAGTGCTCAAGGGG No data
Right 1003532600 6:6950255-6950277 ACCATGCCCAGCTAGTTTTTTGG No data
1003532595_1003532602 16 Left 1003532595 6:6950217-6950239 CCTGGGCTCAAGTGCTCAAGGGG No data
Right 1003532602 6:6950256-6950278 CCATGCCCAGCTAGTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003532595 Original CRISPR CCCCTTGAGCACTTGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr