ID: 1003535147

View in Genome Browser
Species Human (GRCh38)
Location 6:6969976-6969998
Sequence GATTTGCCCTGGGCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003535139_1003535147 4 Left 1003535139 6:6969949-6969971 CCTGAGGCTGCCACGCCTCTCTT No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535134_1003535147 16 Left 1003535134 6:6969937-6969959 CCACCGCCCTGCCCTGAGGCTGC No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535141_1003535147 -6 Left 1003535141 6:6969959-6969981 CCACGCCTCTCTTCCTGGATTTG No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535135_1003535147 13 Left 1003535135 6:6969940-6969962 CCGCCCTGCCCTGAGGCTGCCAC No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535136_1003535147 10 Left 1003535136 6:6969943-6969965 CCCTGCCCTGAGGCTGCCACGCC No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535131_1003535147 20 Left 1003535131 6:6969933-6969955 CCACCCACCGCCCTGCCCTGAGG No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535137_1003535147 9 Left 1003535137 6:6969944-6969966 CCTGCCCTGAGGCTGCCACGCCT No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535133_1003535147 17 Left 1003535133 6:6969936-6969958 CCCACCGCCCTGCCCTGAGGCTG No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data
1003535138_1003535147 5 Left 1003535138 6:6969948-6969970 CCCTGAGGCTGCCACGCCTCTCT No data
Right 1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003535147 Original CRISPR GATTTGCCCTGGGCCTGCCT GGG Intergenic
No off target data available for this crispr