ID: 1003535777

View in Genome Browser
Species Human (GRCh38)
Location 6:6974082-6974104
Sequence ACTTTTGAATAGCCGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003535777_1003535785 24 Left 1003535777 6:6974082-6974104 CCCCAACCCGGCTATTCAAAAGT No data
Right 1003535785 6:6974129-6974151 AGCAGCAGACTTCCTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003535777 Original CRISPR ACTTTTGAATAGCCGGGTTG GGG (reversed) Intergenic
No off target data available for this crispr