ID: 1003537166

View in Genome Browser
Species Human (GRCh38)
Location 6:6985459-6985481
Sequence TCTGCTTGCCCTCACCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003537166_1003537177 25 Left 1003537166 6:6985459-6985481 CCAGTATGGTGAGGGCAAGCAGA No data
Right 1003537177 6:6985507-6985529 GAGAGAAAGAGGTGTAGGCCAGG No data
1003537166_1003537173 -5 Left 1003537166 6:6985459-6985481 CCAGTATGGTGAGGGCAAGCAGA No data
Right 1003537173 6:6985477-6985499 GCAGAGTTGGGGGGAAAGGAAGG No data
1003537166_1003537172 -9 Left 1003537166 6:6985459-6985481 CCAGTATGGTGAGGGCAAGCAGA No data
Right 1003537172 6:6985473-6985495 GCAAGCAGAGTTGGGGGGAAAGG No data
1003537166_1003537174 3 Left 1003537166 6:6985459-6985481 CCAGTATGGTGAGGGCAAGCAGA No data
Right 1003537174 6:6985485-6985507 GGGGGGAAAGGAAGGATAGCTGG No data
1003537166_1003537176 20 Left 1003537166 6:6985459-6985481 CCAGTATGGTGAGGGCAAGCAGA No data
Right 1003537176 6:6985502-6985524 AGCTGGAGAGAAAGAGGTGTAGG No data
1003537166_1003537175 14 Left 1003537166 6:6985459-6985481 CCAGTATGGTGAGGGCAAGCAGA No data
Right 1003537175 6:6985496-6985518 AAGGATAGCTGGAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003537166 Original CRISPR TCTGCTTGCCCTCACCATAC TGG (reversed) Intergenic
No off target data available for this crispr