ID: 1003539302

View in Genome Browser
Species Human (GRCh38)
Location 6:7004079-7004101
Sequence AGGGAGAAACGCAGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003539302_1003539308 23 Left 1003539302 6:7004079-7004101 CCAGGAGCCCTGCGTTTCTCCCT No data
Right 1003539308 6:7004125-7004147 AATACATCCCTAAACCTCATGGG No data
1003539302_1003539307 22 Left 1003539302 6:7004079-7004101 CCAGGAGCCCTGCGTTTCTCCCT No data
Right 1003539307 6:7004124-7004146 GAATACATCCCTAAACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003539302 Original CRISPR AGGGAGAAACGCAGGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr