ID: 1003545960

View in Genome Browser
Species Human (GRCh38)
Location 6:7058629-7058651
Sequence ACTGCCAAATACCACACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003545960_1003545966 13 Left 1003545960 6:7058629-7058651 CCCAGGGTGTGGTATTTGGCAGT No data
Right 1003545966 6:7058665-7058687 GGCTGGCTGATCCTCTTCAAGGG No data
1003545960_1003545964 -4 Left 1003545960 6:7058629-7058651 CCCAGGGTGTGGTATTTGGCAGT No data
Right 1003545964 6:7058648-7058670 CAGTACTCTCAGGAGTAGGCTGG No data
1003545960_1003545963 -8 Left 1003545960 6:7058629-7058651 CCCAGGGTGTGGTATTTGGCAGT No data
Right 1003545963 6:7058644-7058666 TTGGCAGTACTCTCAGGAGTAGG No data
1003545960_1003545968 30 Left 1003545960 6:7058629-7058651 CCCAGGGTGTGGTATTTGGCAGT No data
Right 1003545968 6:7058682-7058704 CAAGGGAGCTGAGTAGTCAGAGG No data
1003545960_1003545965 12 Left 1003545960 6:7058629-7058651 CCCAGGGTGTGGTATTTGGCAGT No data
Right 1003545965 6:7058664-7058686 AGGCTGGCTGATCCTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003545960 Original CRISPR ACTGCCAAATACCACACCCT GGG (reversed) Intergenic
No off target data available for this crispr