ID: 1003550520

View in Genome Browser
Species Human (GRCh38)
Location 6:7098620-7098642
Sequence CAATGCTATGGGCACCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003550520_1003550524 -2 Left 1003550520 6:7098620-7098642 CCTCTGGGGTGCCCATAGCATTG No data
Right 1003550524 6:7098641-7098663 TGAAAGGAAGCTGAAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003550520 Original CRISPR CAATGCTATGGGCACCCCAG AGG (reversed) Intergenic
No off target data available for this crispr