ID: 1003550529

View in Genome Browser
Species Human (GRCh38)
Location 6:7098684-7098706
Sequence CTGAGGGTAAGGAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003550529_1003550545 26 Left 1003550529 6:7098684-7098706 CCTTCTTCTCTCCTTACCCTCAG No data
Right 1003550545 6:7098733-7098755 AATGCTGCCGTACCCAGTCAAGG No data
1003550529_1003550546 30 Left 1003550529 6:7098684-7098706 CCTTCTTCTCTCCTTACCCTCAG No data
Right 1003550546 6:7098737-7098759 CTGCCGTACCCAGTCAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003550529 Original CRISPR CTGAGGGTAAGGAGAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr