ID: 1003550934

View in Genome Browser
Species Human (GRCh38)
Location 6:7101461-7101483
Sequence CTGGAGCAGCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003550934_1003550941 -10 Left 1003550934 6:7101461-7101483 CCCTCCTCCCTCTGCTGCTCCAG No data
Right 1003550941 6:7101474-7101496 GCTGCTCCAGCTCCAGAGGGTGG No data
1003550934_1003550944 5 Left 1003550934 6:7101461-7101483 CCCTCCTCCCTCTGCTGCTCCAG No data
Right 1003550944 6:7101489-7101511 GAGGGTGGTATTTGCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003550934 Original CRISPR CTGGAGCAGCAGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr