ID: 1003552170

View in Genome Browser
Species Human (GRCh38)
Location 6:7108959-7108981
Sequence ACACTCACCCCGCCAACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003552170_1003552175 0 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552175 6:7108982-7109004 TTTCGTGGGAGCCCTCGGTGTGG No data
1003552170_1003552185 27 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552185 6:7109009-7109031 AGCCTGCCTCGCGGGCGGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 468
1003552170_1003552181 23 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552181 6:7109005-7109027 AGCTAGCCTGCCTCGCGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 51
1003552170_1003552186 28 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552186 6:7109010-7109032 GCCTGCCTCGCGGGCGGGGGGGG 0: 1
1: 0
2: 2
3: 39
4: 287
1003552170_1003552180 22 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552180 6:7109004-7109026 GAGCTAGCCTGCCTCGCGGGCGG No data
1003552170_1003552179 19 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552179 6:7109001-7109023 GTGGAGCTAGCCTGCCTCGCGGG No data
1003552170_1003552182 24 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552182 6:7109006-7109028 GCTAGCCTGCCTCGCGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1003552170_1003552178 18 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552178 6:7109000-7109022 TGTGGAGCTAGCCTGCCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 97
1003552170_1003552183 25 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552183 6:7109007-7109029 CTAGCCTGCCTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 62
1003552170_1003552174 -5 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552174 6:7108977-7108999 AGTGTTTTCGTGGGAGCCCTCGG No data
1003552170_1003552184 26 Left 1003552170 6:7108959-7108981 CCTTCCGTTGGCGGGGTGAGTGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1003552184 6:7109008-7109030 TAGCCTGCCTCGCGGGCGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003552170 Original CRISPR ACACTCACCCCGCCAACGGA AGG (reversed) Intronic
902383870 1:16065412-16065434 ACTCTCTGCCCGCCAGCGGAGGG + Intronic
917316057 1:173726509-173726531 AGACTGACACCTCCAACGGACGG + Intronic
1072109239 10:92302219-92302241 ACAGTCAGCCCTCCAACTGAGGG - Intronic
1077139662 11:1018563-1018585 ACACACTCCCCGCCTACGGCGGG - Exonic
1085205963 11:74731999-74732021 ACACTCACCCCACAAAGAGAAGG + Intergenic
1090588928 11:128244445-128244467 ACTCTCACCCCTCCAAGAGAAGG + Intergenic
1097225828 12:57476356-57476378 ACACTCACCCAGCCTGAGGAGGG + Exonic
1097281668 12:57848303-57848325 GCACTCACCCTGCCAAGGAAGGG + Intergenic
1100621528 12:96280422-96280444 AGACTGACCCCGTCAACAGAAGG - Intronic
1106093574 13:26621797-26621819 ACATTCCCACCGCCAAAGGAAGG - Intronic
1111232560 13:85363124-85363146 ACACCCCCCCCGCCAGCAGAGGG - Intergenic
1113904179 13:113811616-113811638 CCACCCACCCCGCCAACCCAGGG - Intronic
1119887377 14:78154222-78154244 CCCCCCACCCCGCCAATGGAGGG + Intergenic
1120226840 14:81800264-81800286 ACACTCACCTCTCCAAAGTAAGG - Intergenic
1130182362 15:81643433-81643455 ACACTGACCCTGCCAACCAAGGG - Intergenic
1132587485 16:711879-711901 ACCCTCACGCCGCCACCAGAGGG + Intronic
1141825188 16:86473673-86473695 ACACCCAGCCCGCCATGGGATGG - Intergenic
1145879680 17:28344197-28344219 CCCCTCACCCCGCCTTCGGAGGG + Intronic
1151457989 17:74238066-74238088 ACACTCCCCGCGCCAAAGGCTGG + Intronic
1151573929 17:74941795-74941817 ACACTCACCCCGCACCCAGAGGG - Exonic
1152613937 17:81329459-81329481 CCACTCACCCCGCCAGAGGAGGG + Intronic
1164250494 19:23470907-23470929 ACACGCACTTAGCCAACGGAAGG - Intergenic
1164302175 19:23972189-23972211 ACACACGCCCCGCCATCGGAAGG + Intergenic
1166915300 19:46191361-46191383 ACCCTCACCCCGCCCTGGGAGGG - Intergenic
926314238 2:11697637-11697659 CCACTCACCCTGCCAATGAATGG - Intronic
932085155 2:68751210-68751232 TCACTCACCCAGCCAATGGGGGG + Intronic
932137537 2:69244053-69244075 ACACTCAGCTCTGCAACGGAGGG - Intronic
943218730 2:185076037-185076059 ACTCTCACCTCCCCAACGTATGG + Intergenic
943416732 2:187616265-187616287 ACATTCACCTAGCCAAAGGATGG + Intergenic
1174109936 20:48192054-48192076 ACACTCACCTTGCCAACCCATGG - Intergenic
1180953628 22:19731639-19731661 CCACCCACCCTGCCAACGGGTGG + Intergenic
949575992 3:5339754-5339776 ACACTCACCTTGACAAAGGATGG - Intergenic
954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG + Intronic
966626914 3:182027030-182027052 ACACTTACCCTGCCAACGATTGG + Intergenic
972802326 4:42490067-42490089 ACACTCAGCCAGGCAAGGGAGGG + Intronic
1000983374 5:167840886-167840908 ACAATTACCCCACAAACGGAGGG - Intronic
1003552170 6:7108959-7108981 ACACTCACCCCGCCAACGGAAGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1022529416 7:31057697-31057719 CCACTCACCCCTCAAAGGGAGGG - Intronic
1026323785 7:69290591-69290613 ACACTCTCCCTGCCAAAGGTAGG - Intergenic
1034023481 7:147670902-147670924 ACACTCAAGCCGTCCACGGATGG + Intronic
1036221864 8:6928160-6928182 ACAATCACCACGCCAACAGACGG + Intergenic
1049095129 8:140544205-140544227 ACACTCACGGCGGCAATGGAGGG + Exonic
1196859748 X:120015793-120015815 GCACTCACCCCGCCCAGGGTGGG - Intergenic