ID: 1003552286

View in Genome Browser
Species Human (GRCh38)
Location 6:7109306-7109328
Sequence CTCCCCGCTCGCGGTCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003552258_1003552286 30 Left 1003552258 6:7109253-7109275 CCCCCCCGCCCCCAACTTCCCGC 0: 1
1: 0
2: 5
3: 96
4: 941
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552273_1003552286 11 Left 1003552273 6:7109272-7109294 CCGCACAAGCCTTGGGCCGGGCC 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552261_1003552286 27 Left 1003552261 6:7109256-7109278 CCCCGCCCCCAACTTCCCGCACA 0: 1
1: 0
2: 2
3: 23
4: 306
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552267_1003552286 19 Left 1003552267 6:7109264-7109286 CCAACTTCCCGCACAAGCCTTGG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552276_1003552286 -10 Left 1003552276 6:7109293-7109315 CCCCCCGCGCCCCCTCCCCGCTC 0: 1
1: 4
2: 21
3: 302
4: 2319
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552262_1003552286 26 Left 1003552262 6:7109257-7109279 CCCGCCCCCAACTTCCCGCACAA 0: 1
1: 0
2: 1
3: 21
4: 257
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552272_1003552286 12 Left 1003552272 6:7109271-7109293 CCCGCACAAGCCTTGGGCCGGGC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552275_1003552286 -5 Left 1003552275 6:7109288-7109310 CCGGGCCCCCCGCGCCCCCTCCC 0: 1
1: 3
2: 28
3: 604
4: 2959
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552264_1003552286 22 Left 1003552264 6:7109261-7109283 CCCCCAACTTCCCGCACAAGCCT 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552274_1003552286 2 Left 1003552274 6:7109281-7109303 CCTTGGGCCGGGCCCCCCGCGCC 0: 1
1: 1
2: 4
3: 44
4: 413
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552265_1003552286 21 Left 1003552265 6:7109262-7109284 CCCCAACTTCCCGCACAAGCCTT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552260_1003552286 28 Left 1003552260 6:7109255-7109277 CCCCCGCCCCCAACTTCCCGCAC 0: 1
1: 0
2: 1
3: 53
4: 513
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552263_1003552286 25 Left 1003552263 6:7109258-7109280 CCGCCCCCAACTTCCCGCACAAG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552266_1003552286 20 Left 1003552266 6:7109263-7109285 CCCAACTTCCCGCACAAGCCTTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data
1003552259_1003552286 29 Left 1003552259 6:7109254-7109276 CCCCCCGCCCCCAACTTCCCGCA 0: 1
1: 1
2: 1
3: 61
4: 578
Right 1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003552286 Original CRISPR CTCCCCGCTCGCGGTCTCTT AGG Intronic
No off target data available for this crispr