ID: 1003552363

View in Genome Browser
Species Human (GRCh38)
Location 6:7109565-7109587
Sequence GCGGCGCCTGTCAAGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003552363_1003552366 -3 Left 1003552363 6:7109565-7109587 CCGGGCCGCTTGACAGGCGCCGC No data
Right 1003552366 6:7109585-7109607 CGCGTGCAGCTCGCGCCCCTCGG No data
1003552363_1003552374 30 Left 1003552363 6:7109565-7109587 CCGGGCCGCTTGACAGGCGCCGC No data
Right 1003552374 6:7109618-7109640 TCCGTGATGGGTTATAAAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 63
1003552363_1003552371 18 Left 1003552363 6:7109565-7109587 CCGGGCCGCTTGACAGGCGCCGC No data
Right 1003552371 6:7109606-7109628 GGCCGCCGTGCATCCGTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1003552363_1003552370 17 Left 1003552363 6:7109565-7109587 CCGGGCCGCTTGACAGGCGCCGC No data
Right 1003552370 6:7109605-7109627 CGGCCGCCGTGCATCCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003552363 Original CRISPR GCGGCGCCTGTCAAGCGGCC CGG (reversed) Intronic