ID: 1003552944

View in Genome Browser
Species Human (GRCh38)
Location 6:7115158-7115180
Sequence TCTCCTCTTGAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003552939_1003552944 -3 Left 1003552939 6:7115138-7115160 CCGGGTGCTCTGTCCATACATCT 0: 1
1: 0
2: 1
3: 12
4: 186
Right 1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG 0: 1
1: 0
2: 2
3: 16
4: 231
1003552936_1003552944 24 Left 1003552936 6:7115111-7115133 CCGTTTTTATAGGGCAGTGTTTC 0: 1
1: 0
2: 4
3: 19
4: 292
Right 1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG 0: 1
1: 0
2: 2
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003552944 Original CRISPR TCTCCTCTTGAGAGGGTGGA TGG Intronic
900708984 1:4099413-4099435 TCACCTCTTCACAGGGTGGCAGG - Intergenic
900844386 1:5084791-5084813 TCTCCTCTTGGGAGGAAGGATGG - Intergenic
902843055 1:19087651-19087673 TGTCCTCTTTAGAGGCAGGAAGG - Intronic
902895162 1:19474681-19474703 TCTCCTCTTGTGAAGGTGGCAGG - Intronic
903547708 1:24137034-24137056 TCCCCTCTGGAGTGGGTGGAGGG - Intronic
904262687 1:29299048-29299070 TCTCCTCATCTGAGGGTGGTGGG + Intronic
906118740 1:43373273-43373295 TCTCTTCTTGAGAAAGAGGATGG - Intergenic
906195473 1:43927912-43927934 TCACCACTTGAGAGGGGGTATGG + Intronic
908056908 1:60297690-60297712 TCTTCTATTGAGATGATGGAGGG + Intergenic
908793936 1:67812537-67812559 TTTCATCTTGAGAGGTAGGAGGG + Intronic
909546293 1:76851838-76851860 TATCTTCTTGAGAGGGGCGAGGG + Intergenic
911488414 1:98531295-98531317 TCACCTCTTCACAGGGTGGCAGG + Intergenic
912708571 1:111933160-111933182 GCACCTCTTGACAGGGTGGCAGG - Intronic
912740094 1:112186417-112186439 TCTTCCCTTGGGAGGGTGAAGGG + Intergenic
914403003 1:147341406-147341428 TCTCCTCTTGAGAGGGCCACAGG - Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914742382 1:150476112-150476134 TCAACTTTTGAGAGGGTAGAGGG - Intronic
916062457 1:161109539-161109561 TTTACTCTTGAGACTGTGGAAGG - Intronic
917020475 1:170581200-170581222 GTTCCCCTTGGGAGGGTGGAAGG + Intergenic
917791787 1:178503883-178503905 TTTCCTCATGGAAGGGTGGATGG - Intergenic
918065239 1:181096231-181096253 AGTCCTCAAGAGAGGGTGGAGGG - Intergenic
918682654 1:187374284-187374306 TCCCCTCTCTAGAGGGAGGAGGG - Intergenic
919455022 1:197811067-197811089 TCTCCTTTGGAGAGGGAGAAAGG + Intergenic
921184063 1:212655302-212655324 TGTCTTCATTAGAGGGTGGAAGG - Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
924453012 1:244196347-244196369 TCTCCCCTTGAGAGGATCTAAGG + Intergenic
1063696463 10:8340197-8340219 TCTCCTTTTAAGAGGGTGGGTGG + Intergenic
1064186240 10:13164188-13164210 TGTCCTCTTGACAGCATGGATGG + Exonic
1065045384 10:21743642-21743664 TCTCATTTGGAGAGGATGGAGGG + Intergenic
1065476704 10:26146021-26146043 TCTCTTCTTGAAAGGGAGGAGGG - Intronic
1065813003 10:29459710-29459732 TCTCCTTTTGGGTGGGTGGATGG + Intronic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1071978209 10:90976558-90976580 GCTCCTGTTGAGTAGGTGGATGG + Intergenic
1072418403 10:95268821-95268843 TCTCCTCTGGTGACGGAGGAAGG - Exonic
1072716375 10:97755497-97755519 TGTCCTCATGAGAAGGTGGGAGG + Intronic
1073083712 10:100875244-100875266 TCTCCCCTAGAGAGGAGGGAAGG + Intergenic
1074214986 10:111375371-111375393 TCTCCTCTTGACAGTCTAGAGGG - Intergenic
1074422439 10:113321165-113321187 TCTCCTTTTGGGAGGATGGGCGG + Intergenic
1074423975 10:113334852-113334874 CCTGCTCTTGTGAGGGTTGAGGG - Intergenic
1075311232 10:121415428-121415450 TTTACTCTTGAGTGGCTGGAAGG - Intergenic
1077613753 11:3660667-3660689 TCTCCTGGTCAGAGGCTGGAAGG + Intronic
1078131492 11:8617848-8617870 TATCCTCTTCAGAGTGTGGATGG - Exonic
1078437282 11:11335858-11335880 TCTCCCCTCGAGATGCTGGAGGG + Intronic
1078469456 11:11575422-11575444 TCTCCTCCTGAGAGGTCAGAGGG - Intronic
1079324995 11:19484242-19484264 TCCTATCTTGAGAGGTTGGAAGG + Intronic
1080639344 11:34149716-34149738 TCCTCTCTTGAGAGGGTGAGTGG - Intergenic
1081700265 11:45148020-45148042 TTTCCTCTTGGGAGGGAGGAAGG + Intronic
1083204338 11:61139042-61139064 GTTGCTCATGAGAGGGTGGAGGG - Intronic
1085637548 11:78170151-78170173 GCCCTTCTTAAGAGGGTGGAGGG + Intergenic
1086964499 11:93013751-93013773 AGCCCTATTGAGAGGGTGGAAGG - Intergenic
1087132864 11:94683920-94683942 TTTTCTCTTGAGAGGGAGGCAGG + Intergenic
1087745984 11:101947346-101947368 TCTCCATTTGAGAGGGTTGTAGG + Intronic
1089705067 11:120271884-120271906 TTTCCTTTAAAGAGGGTGGAGGG + Intronic
1091017290 11:132063449-132063471 TCTATTAATGAGAGGGTGGAAGG + Intronic
1091223088 11:133942155-133942177 TTTCCTCTCGAGAAGGAGGATGG + Intronic
1091272675 11:134328845-134328867 TCTCCTGAGGGGAGGGTGGATGG + Intergenic
1092253803 12:6915629-6915651 TCTCCTCTTCCCAGGGGGGAGGG + Exonic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1096007741 12:48185818-48185840 TCACCACTTGAGGAGGTGGAAGG - Exonic
1096536547 12:52278773-52278795 CCTCCTCTTGAGAAGGCAGAAGG + Intronic
1096830134 12:54307359-54307381 GCTCCTCCTTAGAGGATGGAAGG + Intronic
1098306554 12:69108420-69108442 GCTCCACTTGAGAGGGTGGCAGG - Intergenic
1100371514 12:93973092-93973114 TCTCTACTTGCGAGGGTGGCTGG + Intergenic
1101510629 12:105389516-105389538 TCTCCCCTGGAGAGGAGGGAGGG + Intronic
1102626229 12:114237432-114237454 ACTCCTCTTCAGAGGGGGGTGGG - Intergenic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1104979648 12:132568110-132568132 TCCCCTCTGGAGAGGGTTGCTGG - Intronic
1106103071 13:26710799-26710821 TCTCCACTTGGGAAGGTGCAAGG - Intergenic
1107544647 13:41424487-41424509 TTTCCAGTTGAGAAGGTGGACGG + Intergenic
1108825432 13:54407655-54407677 TCTCCAATGGGGAGGGTGGAGGG - Intergenic
1110024161 13:70512603-70512625 ACTTTTCTTGAGAGGATGGAAGG - Intergenic
1111929571 13:94499790-94499812 TCTCCTATGGAGAGAGTGAAGGG - Intergenic
1113380033 13:109795881-109795903 TCTTCTCCTGAGATGGGGGAGGG + Intergenic
1116715323 14:48418636-48418658 TCCACTCTTGTGAAGGTGGAAGG + Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1118236277 14:64008196-64008218 GGTCCTCTTGAGAGGGAGGCAGG - Intronic
1118933673 14:70265834-70265856 TCTACTCTCTAGTGGGTGGAGGG - Intergenic
1120618203 14:86733133-86733155 TTTCCTCTTAAAAAGGTGGATGG + Intergenic
1121169605 14:91842376-91842398 TCTCCCCATGAGAGGGTGACTGG + Intronic
1122058992 14:99124214-99124236 TCTCCTGTTGAATGGGAGGAGGG - Intergenic
1122357148 14:101130105-101130127 TCTCCTCCTGAGTGGAAGGAAGG - Intergenic
1122801906 14:104235221-104235243 GCACCTCTTCACAGGGTGGAAGG - Intergenic
1125714402 15:41811098-41811120 TCACCTTTTGAGAGGCTGGGAGG + Intronic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1129322918 15:74784536-74784558 GCTGCTTCTGAGAGGGTGGAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131006522 15:88983035-88983057 TCTCCTCTTGAGCCTTTGGAGGG - Intergenic
1132016422 15:98321219-98321241 TCTCTTTTTGAAATGGTGGAAGG - Intergenic
1137716265 16:50600144-50600166 TGTCCTATTGAGGGGTTGGAGGG + Intronic
1138134478 16:54509692-54509714 TCTTCTCTTCAGAGGCTGAAGGG + Intergenic
1138392645 16:56681904-56681926 TCCACTCTTGAGAGGCTGAATGG - Intronic
1139668567 16:68475455-68475477 TCTCCTGTTGAGAAAGCGGATGG - Intergenic
1140119377 16:72070403-72070425 TGTCCTCATAAAAGGGTGGAAGG + Intronic
1141749858 16:85951218-85951240 TCACCTCTAGAGAGGGGAGACGG - Intergenic
1142249688 16:88985673-88985695 TCTCCCCATGGGTGGGTGGAGGG + Intergenic
1143505887 17:7364943-7364965 TGTCCTCTTGACATGGTGGCTGG + Intergenic
1144334903 17:14259822-14259844 TGGCCTCTTGTGGGGGTGGAGGG - Intergenic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1147160775 17:38568344-38568366 CCTGCTCCTGGGAGGGTGGAGGG - Intronic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1150456760 17:65312489-65312511 TCTCCCCTTGAGACTGGGGAAGG + Intergenic
1150468338 17:65414553-65414575 TTTCCTCTTGTGAGGAGGGAGGG + Intergenic
1151236586 17:72724522-72724544 TTTCCATTTCAGAGGGTGGAGGG - Intronic
1153203935 18:2676352-2676374 TCTCCTCTAGATAAGGTGGTTGG + Intronic
1153983975 18:10336716-10336738 TCTCCTCTTGCCAGCCTGGAAGG - Intergenic
1155170823 18:23265763-23265785 TCCCCACTGGAGAGGGTGGATGG + Intronic
1155298345 18:24406161-24406183 TCACCTGTTGAGACTGTGGAAGG - Intergenic
1155413684 18:25572746-25572768 GCTCCTCTTTACAGGGTGGTAGG + Intergenic
1156361462 18:36387910-36387932 TCTCTTGTGGAGAGGTTGGAGGG + Intronic
1159010491 18:63054769-63054791 GCTCCAGTTGAGAAGGTGGAAGG - Intergenic
1159651551 18:70984621-70984643 TCTCTTCTTGAGAGTGTGCTGGG + Intergenic
1160327750 18:77966597-77966619 CCTCCACTGGAGAGGGTCGAGGG - Intergenic
1163738585 19:18996910-18996932 TGTGCTCTTGAGAGGGAGGGAGG + Intronic
1164264217 19:23597361-23597383 TCTCTTCTGGAGAGGGATGAAGG - Intronic
1166782004 19:45347874-45347896 TCCCCTCATGCGAGGCTGGAGGG + Intronic
926718725 2:15943078-15943100 GCTCCCCAGGAGAGGGTGGAAGG - Intronic
928595240 2:32853830-32853852 TCTCCCCTAGAGAAGGTGTAAGG - Intergenic
929595030 2:43170441-43170463 ACTCCTCCTGGGATGGTGGAAGG + Intergenic
930877213 2:56232578-56232600 GCACCTCTTCACAGGGTGGAAGG - Intronic
930929009 2:56858399-56858421 TGTGCTGTTGAGAGTGTGGATGG + Intergenic
931918278 2:66983415-66983437 TCTGTTCTTGAAAGGGTGCAAGG - Intergenic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
934861808 2:97769934-97769956 TCAACTCTTGGGAGTGTGGATGG + Intronic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
939147342 2:138431766-138431788 TGGCCTTTTGAGAGAGTGGAGGG - Intergenic
939818904 2:146931116-146931138 TGTCCTTTTGATAAGGTGGAGGG + Intergenic
943991309 2:194696209-194696231 TGCCTTTTTGAGAGGGTGGAAGG + Intergenic
945819678 2:214648691-214648713 TCTCCTCTAGAGAGAGGTGAAGG - Intergenic
947048600 2:226017695-226017717 TCACCTCTTCACAGGGTGGTAGG + Intergenic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1169607405 20:7338111-7338133 TCCCCTCTTCAGAGATTGGAGGG - Intergenic
1173382808 20:42561242-42561264 TTTCCTCTTGAGTTTGTGGAAGG - Intronic
1173511910 20:43636258-43636280 TCTCATCTTGTGGGGTTGGAGGG + Intronic
1175928909 20:62484431-62484453 GGTCCTCTGGAGAGGGTGGCTGG + Intergenic
1176556576 21:8256685-8256707 TCTCCTCTTGGGCGGGGGGGGGG + Intergenic
1176575515 21:8439727-8439749 TCTCCTCTTGGGCGGGGGGGGGG + Intergenic
1177031228 21:15983701-15983723 TTTCCTCTTAAGAAGGTGGCTGG - Intergenic
1177259728 21:18713626-18713648 GCACCTCTTCAGAGGGTGGTGGG - Intergenic
1179926581 21:44538423-44538445 TCTCCTCTTGGGGGGGGGGGGGG - Intronic
1180084692 21:45502721-45502743 TCACCCTTGGAGAGGGTGGAGGG + Intronic
1181783600 22:25209732-25209754 TCTCCTTGTGAAAGGGAGGAAGG - Intergenic
1181893211 22:26083151-26083173 TCTCCTCTTGAGATGGCTGGTGG - Intergenic
1182009729 22:26990348-26990370 TCTCCTCTGGAGGGTGTGAAAGG - Intergenic
1183473884 22:38025099-38025121 TGTCCTCTTGAGTGGCTGGAGGG - Intronic
1183699909 22:39445445-39445467 ACCCCTCATGAGACGGTGGAAGG + Intergenic
1185145975 22:49136869-49136891 TCTCCTCTAGAGAGAGCAGAGGG + Intergenic
1203253565 22_KI270733v1_random:128782-128804 TCTCCTCTTGGGCGGGGGGGGGG + Intergenic
1203261620 22_KI270733v1_random:173860-173882 TCTCCTCTTGGGCGGGGGGGGGG + Intergenic
949359274 3:3214654-3214676 TCTGCTCTCTAGAGGGTAGAAGG - Intergenic
949633586 3:5957232-5957254 TGTCATCTTGATTGGGTGGAAGG + Intergenic
949769006 3:7557958-7557980 TCTCCTCAAGAGAGAGTGGAGGG + Intronic
950355969 3:12409587-12409609 TGGACTCTTGAGAGGGTGGGAGG + Intronic
950371056 3:12531027-12531049 GCACCTCTTCAGAGGGTGGCAGG + Intronic
952483197 3:33783404-33783426 TCTCCTCTAGAGCCGCTGGAAGG + Intergenic
953348464 3:42196008-42196030 TCTGCCCTTGAGAGTGGGGAAGG - Intronic
954563251 3:51576565-51576587 TTTAGTCTTGGGAGGGTGGATGG + Intronic
954938007 3:54344655-54344677 TCTCCTCTTGGGTGGGGGAAGGG + Intronic
955882744 3:63565200-63565222 TGTCCTATGGAGAGGGAGGAGGG + Intronic
956369707 3:68545514-68545536 TCTCCTCTTGTGAGATAGGAAGG + Exonic
956755236 3:72379348-72379370 TCTCCTTTTTAGGGGGTGGTGGG + Exonic
957984234 3:87551792-87551814 TCTCCTCCTCAGAGGCTGCAGGG + Intergenic
958918781 3:100079324-100079346 TCACTTCTTGACAGGATGGATGG + Intronic
959902375 3:111674973-111674995 TCCCCTCTGGAGATGGGGGAAGG - Exonic
963310640 3:143706668-143706690 TCTCCTCTGTAAGGGGTGGAGGG + Intronic
965561698 3:170068010-170068032 TCTCCTGTTGAGATGATGGTAGG + Intronic
967005422 3:185378440-185378462 TTTCCTCTTTAAAGGGTGGCTGG - Intronic
969199513 4:5591456-5591478 TCCCCTCTTGGGTGGGTGGGTGG + Intronic
970244723 4:14048417-14048439 TCTCCTCTTGAGAAAGTGGTAGG + Intergenic
970598114 4:17618313-17618335 TTTTTTCTTGAGTGGGTGGAGGG + Intronic
971599964 4:28580400-28580422 TCTCCTGTTGCATGGGTGGAAGG - Intergenic
971681360 4:29705739-29705761 TTTCCTTTTGATAGGGTGGCAGG + Intergenic
974679163 4:65138245-65138267 TCACCTCTTTAAAGGGTGGCAGG + Intergenic
975678058 4:76847392-76847414 TCTCCTCTAGAGACTTTGGAGGG - Intergenic
979117181 4:116840426-116840448 TGTCCTCCTGAGAGAGAGGAGGG - Intergenic
981383830 4:144103858-144103880 TCACCTCTTCACAGGGTGGCAGG + Intergenic
983482805 4:168295985-168296007 TCTTCTCTTCAGAGGGTGAGGGG + Intronic
984349929 4:178577412-178577434 TCTCCTCTTGACAGGGGGATTGG - Intergenic
985578722 5:685601-685623 TCTCTTCTTCTGAGGGCGGAGGG - Intronic
985588916 5:754898-754920 CCTCGTGTTGAAAGGGTGGAGGG - Intronic
985977773 5:3434565-3434587 GCTCCGCTTCAGAGGGTGGTAGG - Intergenic
986224713 5:5801864-5801886 TCTCCTCTTGAGCTTATGGAAGG - Intergenic
986967377 5:13290630-13290652 GGTCCCCTTCAGAGGGTGGAGGG - Intergenic
990483379 5:56233551-56233573 TCTCCAATTGACAGGGAGGATGG + Intergenic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
992912292 5:81407908-81407930 GCTCCTCTTCACAGGGTGGCAGG + Intergenic
992946880 5:81819722-81819744 TCTCCTGTTGAGTTGGAGGAGGG + Intergenic
993972326 5:94434692-94434714 TCTCATGGTGAAAGGGTGGAAGG + Intronic
994089889 5:95800603-95800625 TCTCTTTGTGAGAGGGTGGGTGG + Intronic
995490775 5:112689628-112689650 TCTCCTACAGAGAGGCTGGAGGG - Intergenic
995553852 5:113307716-113307738 GCTGCTCTTGGCAGGGTGGAGGG + Intronic
995673211 5:114631810-114631832 TCTGCTCTGGTGAGGTTGGAGGG - Intergenic
997073209 5:130641802-130641824 TCTCCTGTTTAGAGGAGGGATGG + Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
1001421452 5:171590297-171590319 TCTTTTGCTGAGAGGGTGGATGG - Intergenic
1002172845 5:177385057-177385079 TTGCCCCTTGAGGGGGTGGATGG + Intronic
1002393551 5:178935770-178935792 CCTCCTCTATAGAGGCTGGAAGG - Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1003573203 6:7269342-7269364 TTTCTTCATGGGAGGGTGGATGG - Intronic
1007730968 6:43946118-43946140 ACTCCTATTGAGAGGTAGGAGGG - Intergenic
1008625122 6:53307981-53308003 TGTCCTCTTGAGAGACTGCATGG - Intronic
1009702116 6:67197912-67197934 TTTCCTTTTGAGGGGGTTGAGGG - Intergenic
1011844863 6:91551400-91551422 TCACCTCTTCACAGGGTGGCAGG + Intergenic
1012082763 6:94782160-94782182 TTTAGTCTTGAGAGGGTGTATGG + Intergenic
1013058096 6:106604773-106604795 TACCCTCTTCATAGGGTGGAGGG - Intronic
1014444627 6:121513022-121513044 TCCCCTCTTCACAGGGTGGCAGG - Intergenic
1017723322 6:157259333-157259355 TATTCTGTTGAGATGGTGGAAGG + Intergenic
1021393564 7:20122380-20122402 TCTCCTCTTAAAAAGGTGGCTGG + Intergenic
1023759872 7:43455351-43455373 TTTCCTTTTGAGTGGGTGAATGG - Intronic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1026212995 7:68323468-68323490 TCTGGTCTTGAGAGGGAGCAGGG - Intergenic
1027793930 7:82668410-82668432 CCTCCTCTTCACAGGGTGGCAGG + Intergenic
1028692563 7:93670035-93670057 TCTCTTCTGGAGAGGGATGAAGG + Intronic
1031516242 7:122702533-122702555 TCTCCTCTGGAAAGGGTGTCTGG - Exonic
1032739530 7:134724842-134724864 CCTCCTCTTCTGAGGTTGGATGG + Intergenic
1035072869 7:156157673-156157695 TCTCCTCCTGAGACAGAGGAAGG - Intergenic
1036667688 8:10758291-10758313 TCTCCTCTTGTACGTGTGGAGGG + Intronic
1037728895 8:21506956-21506978 TTTCCTCTGGAGAGGGAGAAAGG + Intergenic
1039904794 8:41778718-41778740 TCTCCCGTTGTGAGGTTGGAGGG + Intronic
1044580007 8:93815758-93815780 TAACGTCTGGAGAGGGTGGATGG - Intronic
1044618572 8:94166874-94166896 TCTCCCCTTGAGACTCTGGAGGG + Intronic
1044853859 8:96454616-96454638 TCTCTTCCTTGGAGGGTGGAGGG + Intergenic
1045614910 8:103898160-103898182 TATACTCTTTAGAGGGTAGAAGG - Intronic
1048184069 8:132223142-132223164 TCTCCTCATGAAAGGAAGGAAGG + Intronic
1048427589 8:134337030-134337052 CCACCTCTTCAGACGGTGGACGG + Intergenic
1049042331 8:140121885-140121907 TCTCCCCTTGAGGGTGTGGGTGG + Intronic
1049419714 8:142511232-142511254 GCGCCTCTGGAGAGGGTGGGTGG + Intronic
1049438384 8:142598113-142598135 TCCCCTCTTGAGCAGGTGGCGGG - Intergenic
1050480795 9:6085176-6085198 TGTCCTCATCAAAGGGTGGAAGG + Intergenic
1051953458 9:22662437-22662459 TATCCTCTTAAAAAGGTGGATGG - Intergenic
1052967167 9:34348891-34348913 GGTCATCTTGAGAGGGTGGGTGG - Intergenic
1058281353 9:103119449-103119471 TCTCCTCTTCACAGGATGGCAGG + Intergenic
1058752552 9:108053229-108053251 TCTCCTCATGACATGGTGGCTGG + Intergenic
1059123469 9:111662132-111662154 TGTCGTCGTGACAGGGTGGACGG + Intronic
1061709242 9:132476336-132476358 CCTCCTCTTGTGGGGCTGGATGG + Intronic
1203469966 Un_GL000220v1:111929-111951 TCTCCTCTTGGGCGGGGGGGGGG + Intergenic
1203477787 Un_GL000220v1:155901-155923 TCTCCTCTTGGGCGGGGGGGGGG + Intergenic
1186053801 X:5627669-5627691 TTTCTTCATGGGAGGGTGGAAGG + Intergenic
1188450166 X:30300831-30300853 TCTCCTCCTGCGAGGGTGTTAGG - Intergenic
1188996674 X:36894905-36894927 TTTCTTCTTCAGAGGGTGGCAGG - Intergenic
1190501904 X:51087585-51087607 ATTCCTCTTTAGATGGTGGATGG + Intergenic
1193615334 X:83680938-83680960 GGTCCTCATGAGAGGGTGGCTGG + Intergenic
1194730488 X:97447621-97447643 TCACCTCTAGAGATGGTGGGTGG + Intronic
1195608490 X:106836185-106836207 GCACCTCTTCACAGGGTGGAAGG + Intronic
1196456372 X:115894266-115894288 TCTCCTCAGCAAAGGGTGGAGGG - Intergenic
1196463260 X:115950274-115950296 TTTCCTCTGCAAAGGGTGGAGGG - Intergenic
1196463809 X:115953145-115953167 TTTCCTCATCAAAGGGTGGAGGG - Intergenic
1198089142 X:133310580-133310602 TCTGCTCTGGTGAGAGTGGAAGG - Intronic
1201430444 Y:13897035-13897057 TGTCCTGTTTAGAGGGGGGATGG + Intergenic