ID: 1003554752

View in Genome Browser
Species Human (GRCh38)
Location 6:7129722-7129744
Sequence GAGGGGTAACATCCTGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003554746_1003554752 -4 Left 1003554746 6:7129703-7129725 CCAGGTGAGCCACCTTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 91
1003554745_1003554752 2 Left 1003554745 6:7129697-7129719 CCAATTCCAGGTGAGCCACCTTC 0: 1
1: 0
2: 1
3: 25
4: 411
Right 1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003554752 Original CRISPR GAGGGGTAACATCCTGTTGT CGG Intronic
902698804 1:18157766-18157788 GAGTGGAAACATCATGGTGTTGG - Intronic
910002767 1:82358498-82358520 GAGAGGTTAAGTCCTGTTGTGGG + Intergenic
915403688 1:155643211-155643233 GATGGGTAACAAACTGTTGCAGG - Intergenic
916133368 1:161630947-161630969 GAGGGGTCCCATCCCTTTGTGGG + Intronic
922965989 1:229691242-229691264 GTGGCTTAACATCCTATTGTAGG + Intergenic
1068381088 10:56254833-56254855 GAGGGGTACCAACCTGATGCTGG + Intergenic
1071053238 10:81476502-81476524 GAAGGCTAAAATCCTGTTTTAGG + Intergenic
1074059440 10:109951464-109951486 GATTGGAAACATCATGTTGTAGG - Intronic
1080811740 11:35711325-35711347 GAGGGTTAAAAACCTGATGTTGG + Intronic
1082332689 11:51240469-51240491 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082343886 11:51403345-51403367 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082353736 11:51545998-51546020 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082395321 11:52151543-52151565 GAGGTGTACAATCCTGTTGATGG + Intergenic
1082420397 11:52513674-52513696 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082440256 11:52800979-52801001 GAGGTGAAAAATCCTGTTGATGG + Intergenic
1082441202 11:52814563-52814585 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082467663 11:53197944-53197966 GAGGTGAAAAATCCTGTTGATGG + Intergenic
1082467720 11:53198795-53198817 GAGGTGTACAATCCTGTTGATGG + Intergenic
1082472846 11:53272965-53272987 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082496210 11:53609216-53609238 GAGGTGAAAAATCCTGTTGATGG + Intergenic
1082507073 11:53766996-53767018 GAGGAGAACAATCCTGTTGTTGG + Intergenic
1082511907 11:53836722-53836744 GAGGTGAACAATCCTGTTGTTGG + Intergenic
1082515347 11:53886041-53886063 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082516407 11:53901344-53901366 GAGGTGAACCATCCTGTTGATGG + Intergenic
1082516808 11:53907293-53907315 GAGGTGAAAAATCCTGTTGATGG + Intergenic
1082520756 11:53964283-53964305 GAGGTGAAAAATCCTGTTGATGG + Intergenic
1082528686 11:54079199-54079221 GAGGTGAACCATCCTGTTGATGG + Intergenic
1091572921 12:1706073-1706095 GAGAGATAACATCATGATGTGGG + Intronic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1097412208 12:59268657-59268679 GAGGGGTACCTGCCTGATGTTGG - Intergenic
1104111876 12:125711759-125711781 GGGTGGTAAGATCCTCTTGTGGG + Intergenic
1117751117 14:58924505-58924527 GAGGGGTACCAATCTGATGTTGG - Intergenic
1119183518 14:72620150-72620172 GAGGGGGAAACTCCAGTTGTGGG - Intronic
1121355033 14:93207127-93207149 GAGGAGTGACATCCGTTTGTCGG + Exonic
1123936519 15:25196682-25196704 GAAGGGTGGCATCCTGTGGTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1133866029 16:9644152-9644174 GAGGGGGAACAGTCTGTTGGTGG + Intergenic
1134653016 16:15925741-15925763 GAGGGTTAACATCCTGTCCCAGG + Intergenic
1135156375 16:20056423-20056445 GAGGGGTAACTTCATTTTGGAGG + Intronic
1143680042 17:8469575-8469597 GAGGGGTAGCAGCGTGCTGTTGG + Intronic
1146973435 17:37091500-37091522 GAGAGTTACCATACTGTTGTGGG + Intronic
1147895955 17:43751525-43751547 GAGGGGCAGCATTTTGTTGTAGG - Intergenic
1149192092 17:54075146-54075168 GATGGGGAACAGCCTGTTGGTGG - Intergenic
1149563830 17:57627983-57628005 GAGGGGAAACATGGTCTTGTAGG + Intronic
1150563267 17:66314026-66314048 TGGGGATAACATCCTGTTATGGG - Intronic
1153023606 18:654784-654806 GGGTGGTAACTTCCGGTTGTCGG + Intronic
1154059754 18:11048095-11048117 GAGGTGTCACATGCTGTTGGTGG - Intronic
1161126809 19:2562521-2562543 GGGGGGAAAAACCCTGTTGTAGG - Intronic
1164415367 19:28042801-28042823 GAGGGGTAAAGGCCTGTTCTTGG - Intergenic
925921778 2:8643457-8643479 GAGGGGTCACATGGTGTTGGGGG + Intergenic
927151263 2:20197841-20197863 GATGGGCAACGTCGTGTTGTGGG - Intergenic
931673234 2:64668422-64668444 GAGGGGTAAAGTACTGTGGTGGG + Intronic
933723839 2:85414966-85414988 CAGTGGTAAGATCCTTTTGTGGG + Intronic
934542344 2:95186272-95186294 TAGGGGTAATATCTTGGTGTTGG - Intergenic
934646759 2:96063429-96063451 GGGGGGTGACCTCCTGTGGTGGG + Intergenic
934840162 2:97619511-97619533 GGGGGGTGACCTCCTGTGGTGGG + Intergenic
942534398 2:176948282-176948304 GAGGAGTCACATACTGTGGTAGG - Intergenic
947412981 2:229862383-229862405 GAGGTGTAACGTTCTGTTTTTGG + Intronic
1169636900 20:7702401-7702423 GAGGAGGAACATCATGGTGTAGG - Intergenic
1171414433 20:24968142-24968164 GAGGGGTCACTTGCTGATGTGGG - Intronic
1172229410 20:33326863-33326885 GTGGGGTAACATCCTATTTCTGG + Intergenic
1172298664 20:33832298-33832320 GAGGGGAAACAGCCTGCTTTGGG - Intronic
1174619801 20:51865319-51865341 CAGGGTTGAGATCCTGTTGTGGG - Intergenic
1178828154 21:36033028-36033050 TGGGGGTCACGTCCTGTTGTGGG + Intergenic
1182714022 22:32340771-32340793 GTGGGGTCAGATCATGTTGTTGG + Intergenic
963295149 3:143537844-143537866 GAGGGCCAGCATCCTGTTGTGGG - Intronic
966095960 3:176203433-176203455 GATGGGAAACAGCCTGTTGGTGG - Intergenic
974903760 4:68032712-68032734 GAGAGGTTAAGTCCTGTTGTGGG - Intergenic
980237211 4:130124003-130124025 CAGGGGACCCATCCTGTTGTTGG - Intergenic
985541690 5:490357-490379 CAGGGGTGACGTCCTGGTGTGGG + Intronic
986814686 5:11395862-11395884 GAGGGTTAACAGCCTGGTGCAGG - Intronic
987599016 5:20041007-20041029 GAGCGGTAACATTATGTTGTTGG + Intronic
988329425 5:29815655-29815677 GAAGACTTACATCCTGTTGTAGG + Intergenic
992440391 5:76792996-76793018 GTAGGGTAACTTCCTGATGTTGG + Intergenic
1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG + Intronic
1004555050 6:16688580-16688602 AAGCTGTAACATCCTGTTGGTGG + Intronic
1006167560 6:32073929-32073951 GAGGGGTCTCTTCTTGTTGTGGG + Intronic
1009558500 6:65206963-65206985 GAGAGGGAACATCCTTTTCTTGG - Intronic
1010462993 6:76134240-76134262 GAGGCTTTACATCCTGTTCTGGG + Intergenic
1019155427 6:170035699-170035721 GAGGGGTGACATCAAGTTGGTGG - Intergenic
1021419946 7:20435168-20435190 GAGGGGTAATATCCTTTGGGAGG + Intergenic
1024805381 7:53133044-53133066 CAGGGCTAACATCAAGTTGTGGG - Intergenic
1025480805 7:60980696-60980718 CAGGGGTAACATCAAGTTTTGGG + Intergenic
1030166353 7:106559814-106559836 GAGGGGTACCCTCCTGTTTGAGG + Intergenic
1033642882 7:143279182-143279204 GAGGGGTACCATCCTGTCACTGG - Intergenic
1037614635 8:20507748-20507770 ATAGGGTAACTTCCTGTTGTTGG - Intergenic
1039923866 8:41911648-41911670 GAGCCTTAACATTCTGTTGTTGG - Intergenic
1048568538 8:135629964-135629986 GAGGGGAAACATTCTGCTGCTGG + Intronic
1050111328 9:2219621-2219643 GAGTGGTAAGATCATGTTTTGGG + Intergenic
1059023235 9:110598598-110598620 GATGGGTATCTGCCTGTTGTGGG + Intergenic
1060361238 9:122959605-122959627 GAGGGGCAAGAACCTGTTATTGG + Intronic
1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG + Intronic
1195816343 X:108893659-108893681 GAAGGGTACCATCCACTTGTGGG + Intergenic
1199339470 X:146660002-146660024 GCAGGGTAATATACTGTTGTAGG + Intergenic