ID: 1003554752

View in Genome Browser
Species Human (GRCh38)
Location 6:7129722-7129744
Sequence GAGGGGTAACATCCTGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003554745_1003554752 2 Left 1003554745 6:7129697-7129719 CCAATTCCAGGTGAGCCACCTTC No data
Right 1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 91
1003554746_1003554752 -4 Left 1003554746 6:7129703-7129725 CCAGGTGAGCCACCTTCGAGAGG No data
Right 1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003554752 Original CRISPR GAGGGGTAACATCCTGTTGT CGG Intronic