ID: 1003556018

View in Genome Browser
Species Human (GRCh38)
Location 6:7141092-7141114
Sequence GGAGCCCTGACGCGGGCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556018_1003556030 12 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556030 6:7141127-7141149 GCCCCCTCGGGCCGCCCCCAGGG No data
1003556018_1003556029 11 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556029 6:7141126-7141148 GGCCCCCTCGGGCCGCCCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 320
1003556018_1003556037 24 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556018_1003556026 -1 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556026 6:7141114-7141136 CACGGCCGCAGGGGCCCCCTCGG No data
1003556018_1003556035 21 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556018_1003556038 25 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556038 6:7141140-7141162 GCCCCCAGGGCTCCCGCGGTGGG No data
1003556018_1003556027 0 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556027 6:7141115-7141137 ACGGCCGCAGGGGCCCCCTCGGG No data
1003556018_1003556024 -10 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556024 6:7141105-7141127 TCAGGGCTCCACGGCCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556018 Original CRISPR GGAGCCCTGACGCGGGCAGT CGG (reversed) Intronic