ID: 1003556020

View in Genome Browser
Species Human (GRCh38)
Location 6:7141099-7141121
Sequence CGGCCGTGGAGCCCTGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556020_1003556037 17 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556020_1003556027 -7 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556027 6:7141115-7141137 ACGGCCGCAGGGGCCCCCTCGGG No data
1003556020_1003556026 -8 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556026 6:7141114-7141136 CACGGCCGCAGGGGCCCCCTCGG No data
1003556020_1003556029 4 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556029 6:7141126-7141148 GGCCCCCTCGGGCCGCCCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 320
1003556020_1003556038 18 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556038 6:7141140-7141162 GCCCCCAGGGCTCCCGCGGTGGG No data
1003556020_1003556035 14 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556020_1003556030 5 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556030 6:7141127-7141149 GCCCCCTCGGGCCGCCCCCAGGG No data
1003556020_1003556043 25 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556020 Original CRISPR CGGCCGTGGAGCCCTGACGC GGG (reversed) Intronic